Forum für Wissenschaft, Industrie und Wirtschaft

Hauptsponsoren:     3M 
Datenbankrecherche:

 

Orientierung im Buchstaben-Dschungel der Gene

15.08.2002


Suchmaschine "NGFN-BLAST" erleichtert Vergleich genetischer Daten im Internet

Die frei zugängliche Gen-Suchmaschine "NGFN-BLAST" der Gesellschaft für Biotechnologische Forschung (GBF) erleichtert es jetzt Wissenschaftlern herauszufinden, welche Informationen sich hinter ermittelten genetischen Sequenzen verbergen. Als erster öffentlicher BLAST-Server in Deutschland erlaubt der Dienst den Sequenzvergleich mit speziellen, durch die Nutzergemeinde ausgewählten Untergruppen wie zum Beispiel Mensch, Maus oder Ratte. Der BLAST-Server (BLAST = Basic Local Alignment Search Tool) ist Teil der Forschungsarbeiten der GBF im Nationalen Genomforschungsnetz (NGFN). Mitglieder aus dem NGFN erhalten einen bevorzugten Zugriff zu den Daten und können sich ihr Wunschmenü an Untergruppen zusammenstellen. Eine weitere Besonderheit des Dienstes ist der Verweis auf bereits patentierte Sequenzen. Für die wirtschaftliche Nutzung genetischer Daten ist dieser Service von hoher Bedeutung.

Ähnliche Buchstabenabfolgen in den Gensequenzen weisen oft auf eine Verwandschaft der kodierten Eiweiße hin und erlauben Rückschlüsse auf die Funktion der Gene. Zurzeit gibt es drei öffentliche Gendatenbanken, die Sequenzvergleiche ermöglichen. Deren Daten werden in den USA, Großbritannien und Japan gesammelt und abgeglichen. Eine gezielte Suche ist oft sehr mühsam, da bisher meist die passenden Gensequenzen aller in der Datenbank vorhandenen Organismen aufgelistet werden. Der NGFN-BLAST-Server greift auf diese Daten zurück, aktualisiert sie jedoch täglich, prüft sie auf Unstimmigkeiten und sortiert sie gemäß der gewünschten Untergruppen. Das System ist so flexibel, dass es bei Bedarf um zusätzliche Untergruppen erweitert werden kann. Damit ist der Dienst ein wichtiges Werkzeug, um die Datenberge aus der Genomforschung nicht nur zu sammeln, sondern auch zu interpretieren.

Arbeitsweise des Dienstes: Beispiel Interferon

Gibt man zum Beispiel die Gensequenz "AAAACCTTAAGAAATATTTT" in das Eingabeformular ein und startet dann eine eingeschränkte Suche nach ähnlichen Genabschnitten in Mensch, Maus und Ratte, so zeigt sich, dass es sich bei der Information um einen Teil des gamma-Interferon-Gens handelt. Interferone spielen eine wichtige Rolle bei der Immunantwort. Sie können bestimmte weiße Blutkörperchen so aktivieren, dass sie Bakterien zerstören. Auch bei Virus-Erkrankungen, wie Gelbsucht, hat sich eine Behandlung mit Interferonen bewährt. Die Suche im NGFN-BLAST zeigt zudem, welche Interferone durch Patente geschützt sind. Veränderungen in der eingegebenen Buchstabenfolge oder bei den Suchparametern führen zu anderen Ergebnissen.

Thomas Gazlig | Presseinformation
Weitere Informationen:
http://www.gbf.de/forschung/ngfn/index.html
http://www.gbf.de/
http://www.rzpd.de/ngfn/

Weitere Berichte zu: BLAST-Server Gensequenz Interferon Sequenzvergleich

Weitere Nachrichten aus der Kategorie Biowissenschaften Chemie:

nachricht Wie Krebszellen Winterschlaf halten
16.07.2018 | Universitätsklinikum Carl Gustav Carus Dresden

nachricht Feinstaub macht Bäume anfälliger gegen Trockenheit
16.07.2018 | Rheinische Friedrich-Wilhelms-Universität Bonn

Alle Nachrichten aus der Kategorie: Biowissenschaften Chemie >>>

Die aktuellsten Pressemeldungen zum Suchbegriff Innovation >>>

Die letzten 5 Focus-News des innovations-reports im Überblick:

Im Focus: Was passiert, wenn wir das Atomgitter eines Magneten plötzlich aufheizen?

„Wir haben jetzt ein klares Bild davon, wie das heiße Atomgitter und die kalten magnetischen Spins eines ferrimagnetischen Nichtleiters miteinander ins Gleichgewicht gelangen“, sagt Ilie Radu, Wissenschaftler am Max-Born-Institut in Berlin. Das internationale Forscherteam fand heraus, dass eine Energieübertragung sehr schnell stattfindet und zu einem neuartigen Zustand der Materie führt, in dem die Spins zwar heiß sind, aber noch nicht ihr gesamtes magnetisches Moment verringert haben. Dieser „Spinüberdruck“ wird durch wesentlich langsamere Prozesse abgebaut, die eine Abgabe von Drehimpuls an das Gitter ermöglichen. Die Forschungsergebnisse sind jetzt in "Science Advances" erschienen.

Magnete faszinieren die Menschheit bereits seit mehreren tausend Jahren und sind im Zeitalter der digitalen Datenspeicherung von großer praktischer Bedeutung....

Im Focus: Erste Beweise für Quelle extragalaktischer Teilchen

Zum ersten Mal ist es gelungen, die kosmische Herkunft höchstenergetischer Neutrinos zu bestimmen. Eine Forschungsgruppe um IceCube-Wissenschaftlerin Elisa Resconi, Sprecherin des Sonderforschungsbereichs SFB1258 an der Technischen Universität München (TUM), liefert ein wichtiges Indiz in der Beweiskette, dass die vom Neutrino-Teleskop IceCube am Südpol detektierten Teilchen mit hoher Wahrscheinlichkeit von einer Galaxie in vier Milliarden Lichtjahren Entfernung stammen.

Um andere Ursprünge mit Gewissheit auszuschließen, untersuchte das Team um die Neutrino-Physikerin Elisa Resconi von der TU München und den Astronom und...

Im Focus: First evidence on the source of extragalactic particles

For the first time ever, scientists have determined the cosmic origin of highest-energy neutrinos. A research group led by IceCube scientist Elisa Resconi, spokesperson of the Collaborative Research Center SFB1258 at the Technical University of Munich (TUM), provides an important piece of evidence that the particles detected by the IceCube neutrino telescope at the South Pole originate from a galaxy four billion light-years away from Earth.

To rule out other origins with certainty, the team led by neutrino physicist Elisa Resconi from the Technical University of Munich and multi-wavelength...

Im Focus: Magnetische Wirbel: Erstmals zwei magnetische Skyrmionenphasen in einem Material entdeckt

Erstmals entdeckte ein Forscherteam in einem Material zwei unabhängige Phasen mit magnetischen Wirbeln, sogenannten Skyrmionen. Die Physiker der Technischen Universitäten München und Dresden sowie von der Universität zu Köln können damit die Eigenschaften dieser für Grundlagenforschung und Anwendungen gleichermaßen interessanten Magnetstrukturen noch eingehender erforschen.

Strudel kennt jeder aus der Badewanne: Wenn das Wasser abgelassen wird, bilden sie sich kreisförmig um den Abfluss. Solche Wirbel sind im Allgemeinen sehr...

Im Focus: Neue Steuerung der Zellteilung entdeckt

Wenn eine Zelle sich teilt, werden sämtliche ihrer Bestandteile gleichmässig auf die Tochterzellen verteilt. UZH-Forschende haben nun ein Enzym identifiziert, das sicherstellt, dass auch Zellbestandteile ohne Membran korrekt aufgeteilt werden. Ihre Entdeckung eröffnet neue Möglichkeiten für die Behandlung von Krebs, neurodegenerative Krankheiten, Alterungsprozessen und Virusinfektionen.

Man kennt es aus der Küche: Werden Aceto balsamico und Olivenöl miteinander vermischt, trennen sich die beiden Flüssigkeiten. Runde Essigtropfen formen sich,...

Alle Focus-News des Innovations-reports >>>

Anzeige

Anzeige

VideoLinks
Industrie & Wirtschaft
Veranstaltungen

Interdisziplinäre Konferenz: Diabetesforscher und Bioingenieure diskutieren Forschungskonzepte

13.07.2018 | Veranstaltungen

Conference on Laser Polishing – LaP: Feintuning für Oberflächen

12.07.2018 | Veranstaltungen

Materialien für eine Nachhaltige Wasserwirtschaft – MachWas-Konferenz in Frankfurt am Main

11.07.2018 | Veranstaltungen

VideoLinks
Wissenschaft & Forschung
Weitere VideoLinks im Überblick >>>
 
Aktuelle Beiträge

Vertikales Begrünungssystem Biolit Vertical Green<sup>®</sup> auf Landesgartenschau Würzburg

16.07.2018 | Architektur Bauwesen

Feinstaub macht Bäume anfälliger gegen Trockenheit

16.07.2018 | Biowissenschaften Chemie

Wie Krebszellen Winterschlaf halten

16.07.2018 | Biowissenschaften Chemie

Weitere B2B-VideoLinks
IHR
JOB & KARRIERE
SERVICE
im innovations-report
in Kooperation mit academics