Forum für Wissenschaft, Industrie und Wirtschaft

Hauptsponsoren:     3M 
Datenbankrecherche:

 

Orientierung im Buchstaben-Dschungel der Gene

15.08.2002


Suchmaschine "NGFN-BLAST" erleichtert Vergleich genetischer Daten im Internet

Die frei zugängliche Gen-Suchmaschine "NGFN-BLAST" der Gesellschaft für Biotechnologische Forschung (GBF) erleichtert es jetzt Wissenschaftlern herauszufinden, welche Informationen sich hinter ermittelten genetischen Sequenzen verbergen. Als erster öffentlicher BLAST-Server in Deutschland erlaubt der Dienst den Sequenzvergleich mit speziellen, durch die Nutzergemeinde ausgewählten Untergruppen wie zum Beispiel Mensch, Maus oder Ratte. Der BLAST-Server (BLAST = Basic Local Alignment Search Tool) ist Teil der Forschungsarbeiten der GBF im Nationalen Genomforschungsnetz (NGFN). Mitglieder aus dem NGFN erhalten einen bevorzugten Zugriff zu den Daten und können sich ihr Wunschmenü an Untergruppen zusammenstellen. Eine weitere Besonderheit des Dienstes ist der Verweis auf bereits patentierte Sequenzen. Für die wirtschaftliche Nutzung genetischer Daten ist dieser Service von hoher Bedeutung.

Ähnliche Buchstabenabfolgen in den Gensequenzen weisen oft auf eine Verwandschaft der kodierten Eiweiße hin und erlauben Rückschlüsse auf die Funktion der Gene. Zurzeit gibt es drei öffentliche Gendatenbanken, die Sequenzvergleiche ermöglichen. Deren Daten werden in den USA, Großbritannien und Japan gesammelt und abgeglichen. Eine gezielte Suche ist oft sehr mühsam, da bisher meist die passenden Gensequenzen aller in der Datenbank vorhandenen Organismen aufgelistet werden. Der NGFN-BLAST-Server greift auf diese Daten zurück, aktualisiert sie jedoch täglich, prüft sie auf Unstimmigkeiten und sortiert sie gemäß der gewünschten Untergruppen. Das System ist so flexibel, dass es bei Bedarf um zusätzliche Untergruppen erweitert werden kann. Damit ist der Dienst ein wichtiges Werkzeug, um die Datenberge aus der Genomforschung nicht nur zu sammeln, sondern auch zu interpretieren.

Arbeitsweise des Dienstes: Beispiel Interferon

Gibt man zum Beispiel die Gensequenz "AAAACCTTAAGAAATATTTT" in das Eingabeformular ein und startet dann eine eingeschränkte Suche nach ähnlichen Genabschnitten in Mensch, Maus und Ratte, so zeigt sich, dass es sich bei der Information um einen Teil des gamma-Interferon-Gens handelt. Interferone spielen eine wichtige Rolle bei der Immunantwort. Sie können bestimmte weiße Blutkörperchen so aktivieren, dass sie Bakterien zerstören. Auch bei Virus-Erkrankungen, wie Gelbsucht, hat sich eine Behandlung mit Interferonen bewährt. Die Suche im NGFN-BLAST zeigt zudem, welche Interferone durch Patente geschützt sind. Veränderungen in der eingegebenen Buchstabenfolge oder bei den Suchparametern führen zu anderen Ergebnissen.

Thomas Gazlig | Presseinformation
Weitere Informationen:
http://www.gbf.de/forschung/ngfn/index.html
http://www.gbf.de/
http://www.rzpd.de/ngfn/

Weitere Berichte zu: BLAST-Server Gensequenz Interferon Sequenzvergleich

Weitere Nachrichten aus der Kategorie Biowissenschaften Chemie:

nachricht HZDR-Forscher entwickeln Tarnkappen-Technologie für leuchtende Nanopartikel
13.11.2018 | Helmholtz-Zentrum Dresden-Rossendorf

nachricht Ein Chip mit echten Blutgefäßen
13.11.2018 | Technische Universität Wien

Alle Nachrichten aus der Kategorie: Biowissenschaften Chemie >>>

Die aktuellsten Pressemeldungen zum Suchbegriff Innovation >>>

Die letzten 5 Focus-News des innovations-reports im Überblick:

Im Focus: Ein Chip mit echten Blutgefäßen

An der TU Wien wurden Bio-Chips entwickelt, in denen man Gewebe herstellen und untersuchen kann. Die Stoffzufuhr lässt sich dabei sehr präzise dosieren.

Menschliche Zellen in der Petrischale zu vermehren, ist heute keine große Herausforderung mehr. Künstliches Gewebe herzustellen, durchzogen von feinen...

Im Focus: A Chip with Blood Vessels

Biochips have been developed at TU Wien (Vienna), on which tissue can be produced and examined. This allows supplying the tissue with different substances in a very controlled way.

Cultivating human cells in the Petri dish is not a big challenge today. Producing artificial tissue, however, permeated by fine blood vessels, is a much more...

Im Focus: Optimierung von Legierungswerkstoffen: Diffusionsvorgänge in Nanoteilchen entschlüsselt

Ein Forschungsteam der TU Graz entdeckt atomar ablaufende Prozesse, die neue Ansätze zur Verbesserung von Materialeigenschaften liefern.

Aluminiumlegierungen verfügen über einzigartige Materialeigenschaften und sind unverzichtbare Werkstoffe im Flugzeugbau sowie in der Weltraumtechnik.

Im Focus: Graphen auf dem Weg zur Supraleitung

Doppelschichten aus Graphen haben eine Eigenschaft, die ihnen erlauben könnte, Strom völlig widerstandslos zu leiten. Dies zeigt nun eine Arbeit an BESSY II. Ein Team hat dafür die Bandstruktur dieser Proben mit extrem hoher Präzision ausgemessen und an einer überraschenden Stelle einen flachen Bereich entdeckt. Möglich wurde dies durch die extrem hohe Auflösung des ARPES-Instruments an BESSY II.

Aus reinem Kohlenstoff bestehen so unterschiedliche Materialien wie Diamant, Graphit oder Graphen. In Graphen bilden die Kohlenstoffatome ein zweidimensionales...

Im Focus: Datensicherheit: Aufbruch in die Quantentechnologie

Den Datenverkehr noch schneller und abhörsicher machen: Darauf zielt ein neues Verbundprojekt ab, an dem Physiker der Uni Würzburg beteiligt sind. Das Bundesforschungsministerium fördert das Projekt mit 14,8 Millionen Euro.

Je stärker die Digitalisierung voranschreitet, umso mehr gewinnen Datensicherheit und sichere Kommunikation an Bedeutung. Für diese Ziele ist die...

Alle Focus-News des Innovations-reports >>>

Anzeige

Anzeige

VideoLinks
Industrie & Wirtschaft
Veranstaltungen

Tagung informiert über künstliche Intelligenz

13.11.2018 | Veranstaltungen

Wer rechnet schneller? Algorithmen und ihre gesellschaftliche Überwachung

12.11.2018 | Veranstaltungen

Profilierte Ausblicke auf die Mobilität von morgen

12.11.2018 | Veranstaltungen

VideoLinks
Wissenschaft & Forschung
Weitere VideoLinks im Überblick >>>
 
Aktuelle Beiträge

MagicMoney: Offline bezahlen – mit deinem Smartphone

13.11.2018 | Wirtschaft Finanzen

5G sichert Zukunft von Industrie 4.0 – DFKI mit der SmartFactoryKL auf der SPS IPC Drives

13.11.2018 | Messenachrichten

Tagung informiert über künstliche Intelligenz

13.11.2018 | Veranstaltungsnachrichten

Weitere B2B-VideoLinks
IHR
JOB & KARRIERE
SERVICE
im innovations-report
in Kooperation mit academics