Orientierung im Buchstaben-Dschungel der Gene

Suchmaschine „NGFN-BLAST“ erleichtert Vergleich genetischer Daten im Internet

Die frei zugängliche Gen-Suchmaschine „NGFN-BLAST“ der Gesellschaft für Biotechnologische Forschung (GBF) erleichtert es jetzt Wissenschaftlern herauszufinden, welche Informationen sich hinter ermittelten genetischen Sequenzen verbergen. Als erster öffentlicher BLAST-Server in Deutschland erlaubt der Dienst den Sequenzvergleich mit speziellen, durch die Nutzergemeinde ausgewählten Untergruppen wie zum Beispiel Mensch, Maus oder Ratte. Der BLAST-Server (BLAST = Basic Local Alignment Search Tool) ist Teil der Forschungsarbeiten der GBF im Nationalen Genomforschungsnetz (NGFN). Mitglieder aus dem NGFN erhalten einen bevorzugten Zugriff zu den Daten und können sich ihr Wunschmenü an Untergruppen zusammenstellen. Eine weitere Besonderheit des Dienstes ist der Verweis auf bereits patentierte Sequenzen. Für die wirtschaftliche Nutzung genetischer Daten ist dieser Service von hoher Bedeutung.

Ähnliche Buchstabenabfolgen in den Gensequenzen weisen oft auf eine Verwandschaft der kodierten Eiweiße hin und erlauben Rückschlüsse auf die Funktion der Gene. Zurzeit gibt es drei öffentliche Gendatenbanken, die Sequenzvergleiche ermöglichen. Deren Daten werden in den USA, Großbritannien und Japan gesammelt und abgeglichen. Eine gezielte Suche ist oft sehr mühsam, da bisher meist die passenden Gensequenzen aller in der Datenbank vorhandenen Organismen aufgelistet werden. Der NGFN-BLAST-Server greift auf diese Daten zurück, aktualisiert sie jedoch täglich, prüft sie auf Unstimmigkeiten und sortiert sie gemäß der gewünschten Untergruppen. Das System ist so flexibel, dass es bei Bedarf um zusätzliche Untergruppen erweitert werden kann. Damit ist der Dienst ein wichtiges Werkzeug, um die Datenberge aus der Genomforschung nicht nur zu sammeln, sondern auch zu interpretieren.

Arbeitsweise des Dienstes: Beispiel Interferon

Gibt man zum Beispiel die Gensequenz „AAAACCTTAAGAAATATTTT“ in das Eingabeformular ein und startet dann eine eingeschränkte Suche nach ähnlichen Genabschnitten in Mensch, Maus und Ratte, so zeigt sich, dass es sich bei der Information um einen Teil des gamma-Interferon-Gens handelt. Interferone spielen eine wichtige Rolle bei der Immunantwort. Sie können bestimmte weiße Blutkörperchen so aktivieren, dass sie Bakterien zerstören. Auch bei Virus-Erkrankungen, wie Gelbsucht, hat sich eine Behandlung mit Interferonen bewährt. Die Suche im NGFN-BLAST zeigt zudem, welche Interferone durch Patente geschützt sind. Veränderungen in der eingegebenen Buchstabenfolge oder bei den Suchparametern führen zu anderen Ergebnissen.

Media Contact

Thomas Gazlig Presseinformation

Alle Nachrichten aus der Kategorie: Biowissenschaften Chemie

Der innovations-report bietet im Bereich der "Life Sciences" Berichte und Artikel über Anwendungen und wissenschaftliche Erkenntnisse der modernen Biologie, der Chemie und der Humanmedizin.

Unter anderem finden Sie Wissenswertes aus den Teilbereichen: Bakteriologie, Biochemie, Bionik, Bioinformatik, Biophysik, Biotechnologie, Genetik, Geobotanik, Humanbiologie, Meeresbiologie, Mikrobiologie, Molekularbiologie, Zellbiologie, Zoologie, Bioanorganische Chemie, Mikrochemie und Umweltchemie.

Zurück zur Startseite

Kommentare (0)

Schreiben Sie einen Kommentar

Neueste Beiträge

Mit Lasern in eine mobile Zukunft

Das EU-Infrastrukturprojekt NextGenBat hat ambitionierte Ziele: Die Performance von mobilen Energiespeichern wie Batterien soll mit neuen Materialien und laserbasierten Herstellungsverfahren enorm gesteigert werden. Zum Einsatz kommt dabei ein Ansatz zur…

Aufbruch in die dritte Dimension

Lassen sich auch anspruchsvolle Metallbauteile in Serie produktiv und reproduzierbar 3D-drucken? Forschende aus Aachen bejahen diese Frage: Sie transferierten am Fraunhofer-Institut für Lasertechnik ILT das zweidimensionale Extreme Hochgeschwindigkeits-Laserauftragschweißen EHLA auf…

Motorenforscher starten Messkampagne mit klimaneutralem Wasserstoff

„Wasserstoff und daraus erzeugte synthetische Kraftstoffe werden ein zentraler Baustein der maritimen Energiewende sein“, davon ist Professor Bert Buchholz von der Fakultät für Maschinenbau und Schiffstechnik der Universität Rostock fest…

Partner & Förderer