Forum für Wissenschaft, Industrie und Wirtschaft

Hauptsponsoren:     3M 


Orientierung im Buchstaben-Dschungel der Gene


Suchmaschine "NGFN-BLAST" erleichtert Vergleich genetischer Daten im Internet

Die frei zugängliche Gen-Suchmaschine "NGFN-BLAST" der Gesellschaft für Biotechnologische Forschung (GBF) erleichtert es jetzt Wissenschaftlern herauszufinden, welche Informationen sich hinter ermittelten genetischen Sequenzen verbergen. Als erster öffentlicher BLAST-Server in Deutschland erlaubt der Dienst den Sequenzvergleich mit speziellen, durch die Nutzergemeinde ausgewählten Untergruppen wie zum Beispiel Mensch, Maus oder Ratte. Der BLAST-Server (BLAST = Basic Local Alignment Search Tool) ist Teil der Forschungsarbeiten der GBF im Nationalen Genomforschungsnetz (NGFN). Mitglieder aus dem NGFN erhalten einen bevorzugten Zugriff zu den Daten und können sich ihr Wunschmenü an Untergruppen zusammenstellen. Eine weitere Besonderheit des Dienstes ist der Verweis auf bereits patentierte Sequenzen. Für die wirtschaftliche Nutzung genetischer Daten ist dieser Service von hoher Bedeutung.

Ähnliche Buchstabenabfolgen in den Gensequenzen weisen oft auf eine Verwandschaft der kodierten Eiweiße hin und erlauben Rückschlüsse auf die Funktion der Gene. Zurzeit gibt es drei öffentliche Gendatenbanken, die Sequenzvergleiche ermöglichen. Deren Daten werden in den USA, Großbritannien und Japan gesammelt und abgeglichen. Eine gezielte Suche ist oft sehr mühsam, da bisher meist die passenden Gensequenzen aller in der Datenbank vorhandenen Organismen aufgelistet werden. Der NGFN-BLAST-Server greift auf diese Daten zurück, aktualisiert sie jedoch täglich, prüft sie auf Unstimmigkeiten und sortiert sie gemäß der gewünschten Untergruppen. Das System ist so flexibel, dass es bei Bedarf um zusätzliche Untergruppen erweitert werden kann. Damit ist der Dienst ein wichtiges Werkzeug, um die Datenberge aus der Genomforschung nicht nur zu sammeln, sondern auch zu interpretieren.

Arbeitsweise des Dienstes: Beispiel Interferon

Gibt man zum Beispiel die Gensequenz "AAAACCTTAAGAAATATTTT" in das Eingabeformular ein und startet dann eine eingeschränkte Suche nach ähnlichen Genabschnitten in Mensch, Maus und Ratte, so zeigt sich, dass es sich bei der Information um einen Teil des gamma-Interferon-Gens handelt. Interferone spielen eine wichtige Rolle bei der Immunantwort. Sie können bestimmte weiße Blutkörperchen so aktivieren, dass sie Bakterien zerstören. Auch bei Virus-Erkrankungen, wie Gelbsucht, hat sich eine Behandlung mit Interferonen bewährt. Die Suche im NGFN-BLAST zeigt zudem, welche Interferone durch Patente geschützt sind. Veränderungen in der eingegebenen Buchstabenfolge oder bei den Suchparametern führen zu anderen Ergebnissen.

Thomas Gazlig | Presseinformation
Weitere Informationen:

Weitere Berichte zu: BLAST-Server Gensequenz Interferon Sequenzvergleich

Weitere Nachrichten aus der Kategorie Biowissenschaften Chemie:

nachricht Eine Karte der Zellkraftwerke
18.08.2017 | Albert-Ludwigs-Universität Freiburg im Breisgau

nachricht Chronische Infektionen aushebeln: Ein neuer Wirkstoff auf dem Weg in die Entwicklung
18.08.2017 | Deutsches Zentrum für Infektionsforschung

Alle Nachrichten aus der Kategorie: Biowissenschaften Chemie >>>

Die aktuellsten Pressemeldungen zum Suchbegriff Innovation >>>

Die letzten 5 Focus-News des innovations-reports im Überblick:

Im Focus: Unterwasserroboter soll nach einem Jahr in der arktischen Tiefsee auftauchen

Am Dienstag, den 22. August wird das Forschungsschiff Polarstern im norwegischen Tromsø zu einer besonderen Expedition in die Arktis starten: Der autonome Unterwasserroboter TRAMPER soll nach einem Jahr Einsatzzeit am arktischen Tiefseeboden auftauchen. Dieses Gerät und weitere robotische Systeme, die Tiefsee- und Weltraumforscher im Rahmen der Helmholtz-Allianz ROBEX gemeinsam entwickelt haben, werden nun knapp drei Wochen lang unter Realbedingungen getestet. ROBEX hat das Ziel, neue Technologien für die Erkundung schwer erreichbarer Gebiete mit extremen Umweltbedingungen zu entwickeln.

„Auftauchen wird der TRAMPER“, sagt Dr. Frank Wenzhöfer vom Alfred-Wegener-Institut, Helmholtz-Zentrum für Polar- und Meeresforschung (AWI) selbstbewusst. Der...

Im Focus: Mit Barcodes der Zellentwicklung auf der Spur

Darüber, wie sich Blutzellen entwickeln, existieren verschiedene Auffassungen – sie basieren jedoch fast ausschließlich auf Experimenten, die lediglich Momentaufnahmen widerspiegeln. Wissenschaftler des Deutschen Krebsforschungszentrums stellen nun im Fachjournal Nature eine neue Technik vor, mit der sich das Geschehen dynamisch erfassen lässt: Mithilfe eines „Zufallsgenerators“ versehen sie Blutstammzellen mit genetischen Barcodes und können so verfolgen, welche Zelltypen aus der Stammzelle hervorgehen. Diese Technik erlaubt künftig völlig neue Einblicke in die Entwicklung unterschiedlicher Gewebe sowie in die Krebsentstehung.

Wie entsteht die Vielzahl verschiedener Zelltypen im Blut? Diese Frage beschäftigt Wissenschaftler schon lange. Nach der klassischen Vorstellung fächern sich...

Im Focus: Fizzy soda water could be key to clean manufacture of flat wonder material: Graphene

Whether you call it effervescent, fizzy, or sparkling, carbonated water is making a comeback as a beverage. Aside from quenching thirst, researchers at the University of Illinois at Urbana-Champaign have discovered a new use for these "bubbly" concoctions that will have major impact on the manufacturer of the world's thinnest, flattest, and one most useful materials -- graphene.

As graphene's popularity grows as an advanced "wonder" material, the speed and quality at which it can be manufactured will be paramount. With that in mind,...

Im Focus: Forscher entwickeln maisförmigen Arzneimittel-Transporter zum Inhalieren

Er sieht aus wie ein Maiskolben, ist winzig wie ein Bakterium und kann einen Wirkstoff direkt in die Lungenzellen liefern: Das zylinderförmige Vehikel für Arzneistoffe, das Pharmazeuten der Universität des Saarlandes entwickelt haben, kann inhaliert werden. Professor Marc Schneider und sein Team machen sich dabei die körpereigene Abwehr zunutze: Makrophagen, die Fresszellen des Immunsystems, fressen den gesundheitlich unbedenklichen „Nano-Mais“ und setzen dabei den in ihm enthaltenen Wirkstoff frei. Bei ihrer Forschung arbeiteten die Pharmazeuten mit Forschern der Medizinischen Fakultät der Saar-Uni, des Leibniz-Instituts für Neue Materialien und der Universität Marburg zusammen Ihre Forschungsergebnisse veröffentlichten die Wissenschaftler in der Fachzeitschrift Advanced Healthcare Materials. DOI: 10.1002/adhm.201700478

Ein Medikament wirkt nur, wenn es dort ankommt, wo es wirken soll. Wird ein Mittel inhaliert, muss der Wirkstoff in der Lunge zuerst die Hindernisse...

Im Focus: Exotische Quantenzustände: Physiker erzeugen erstmals optische „Töpfe" für ein Super-Photon

Physikern der Universität Bonn ist es gelungen, optische Mulden und komplexere Muster zu erzeugen, in die das Licht eines Bose-Einstein-Kondensates fließt. Die Herstellung solch sehr verlustarmer Strukturen für Licht ist eine Voraussetzung für komplexe Schaltkreise für Licht, beispielsweise für die Quanteninformationsverarbeitung einer neuen Computergeneration. Die Wissenschaftler stellen nun ihre Ergebnisse im Fachjournal „Nature Photonics“ vor.

Lichtteilchen (Photonen) kommen als winzige, unteilbare Portionen vor. Viele Tausend dieser Licht-Portionen lassen sich zu einem einzigen Super-Photon...

Alle Focus-News des Innovations-reports >>>



im innovations-report
in Kooperation mit academics

European Conference on Eye Movements: Internationale Tagung an der Bergischen Universität Wuppertal

18.08.2017 | Veranstaltungen

Einblicke ins menschliche Denken

17.08.2017 | Veranstaltungen

Eröffnung der INC.worX-Erlebniswelt während der Technologie- und Innovationsmanagement-Tagung 2017

16.08.2017 | Veranstaltungen

Weitere VideoLinks >>>
Aktuelle Beiträge

Eine Karte der Zellkraftwerke

18.08.2017 | Biowissenschaften Chemie

Chronische Infektionen aushebeln: Ein neuer Wirkstoff auf dem Weg in die Entwicklung

18.08.2017 | Biowissenschaften Chemie

Computer mit Köpfchen

18.08.2017 | Informationstechnologie