Forum für Wissenschaft, Industrie und Wirtschaft

Hauptsponsoren:     3M 
Datenbankrecherche:

 

Orientierung im Buchstaben-Dschungel der Gene

15.08.2002


Suchmaschine "NGFN-BLAST" erleichtert Vergleich genetischer Daten im Internet

Die frei zugängliche Gen-Suchmaschine "NGFN-BLAST" der Gesellschaft für Biotechnologische Forschung (GBF) erleichtert es jetzt Wissenschaftlern herauszufinden, welche Informationen sich hinter ermittelten genetischen Sequenzen verbergen. Als erster öffentlicher BLAST-Server in Deutschland erlaubt der Dienst den Sequenzvergleich mit speziellen, durch die Nutzergemeinde ausgewählten Untergruppen wie zum Beispiel Mensch, Maus oder Ratte. Der BLAST-Server (BLAST = Basic Local Alignment Search Tool) ist Teil der Forschungsarbeiten der GBF im Nationalen Genomforschungsnetz (NGFN). Mitglieder aus dem NGFN erhalten einen bevorzugten Zugriff zu den Daten und können sich ihr Wunschmenü an Untergruppen zusammenstellen. Eine weitere Besonderheit des Dienstes ist der Verweis auf bereits patentierte Sequenzen. Für die wirtschaftliche Nutzung genetischer Daten ist dieser Service von hoher Bedeutung.

Ähnliche Buchstabenabfolgen in den Gensequenzen weisen oft auf eine Verwandschaft der kodierten Eiweiße hin und erlauben Rückschlüsse auf die Funktion der Gene. Zurzeit gibt es drei öffentliche Gendatenbanken, die Sequenzvergleiche ermöglichen. Deren Daten werden in den USA, Großbritannien und Japan gesammelt und abgeglichen. Eine gezielte Suche ist oft sehr mühsam, da bisher meist die passenden Gensequenzen aller in der Datenbank vorhandenen Organismen aufgelistet werden. Der NGFN-BLAST-Server greift auf diese Daten zurück, aktualisiert sie jedoch täglich, prüft sie auf Unstimmigkeiten und sortiert sie gemäß der gewünschten Untergruppen. Das System ist so flexibel, dass es bei Bedarf um zusätzliche Untergruppen erweitert werden kann. Damit ist der Dienst ein wichtiges Werkzeug, um die Datenberge aus der Genomforschung nicht nur zu sammeln, sondern auch zu interpretieren.

Arbeitsweise des Dienstes: Beispiel Interferon

Gibt man zum Beispiel die Gensequenz "AAAACCTTAAGAAATATTTT" in das Eingabeformular ein und startet dann eine eingeschränkte Suche nach ähnlichen Genabschnitten in Mensch, Maus und Ratte, so zeigt sich, dass es sich bei der Information um einen Teil des gamma-Interferon-Gens handelt. Interferone spielen eine wichtige Rolle bei der Immunantwort. Sie können bestimmte weiße Blutkörperchen so aktivieren, dass sie Bakterien zerstören. Auch bei Virus-Erkrankungen, wie Gelbsucht, hat sich eine Behandlung mit Interferonen bewährt. Die Suche im NGFN-BLAST zeigt zudem, welche Interferone durch Patente geschützt sind. Veränderungen in der eingegebenen Buchstabenfolge oder bei den Suchparametern führen zu anderen Ergebnissen.

Thomas Gazlig | Presseinformation
Weitere Informationen:
http://www.gbf.de/forschung/ngfn/index.html
http://www.gbf.de/
http://www.rzpd.de/ngfn/

Weitere Berichte zu: BLAST-Server Gensequenz Interferon Sequenzvergleich

Weitere Nachrichten aus der Kategorie Biowissenschaften Chemie:

nachricht Was nach der Befruchtung im Zellkern passiert
06.12.2016 | Helmholtz Zentrum München - Deutsches Forschungszentrum für Gesundheit und Umwelt

nachricht Forscher vergleichen Biodiversitätstrends mit dem Aktienmarkt
06.12.2016 | Helmholtz-Zentrum für Umweltforschung - UFZ

Alle Nachrichten aus der Kategorie: Biowissenschaften Chemie >>>

Die aktuellsten Pressemeldungen zum Suchbegriff Innovation >>>

Die letzten 5 Focus-News des innovations-reports im Überblick:

Im Focus: Wie sich Zellen gegen Salmonellen verteidigen

Bioinformatiker der Goethe-Universität haben das erste mathematische Modell für einen zentralen Verteidigungsmechanismus der Zelle gegen das Bakterium Salmonella entwickelt. Sie können ihren experimentell arbeitenden Kollegen damit wertvolle Anregungen zur Aufklärung der beteiligten Signalwege geben.

Jedes Jahr sind Salmonellen weltweit für Millionen von Infektionen und tausende Todesfälle verantwortlich. Die Körperzellen können sich aber gegen die...

Im Focus: Shape matters when light meets atom

Mapping the interaction of a single atom with a single photon may inform design of quantum devices

Have you ever wondered how you see the world? Vision is about photons of light, which are packets of energy, interacting with the atoms or molecules in what...

Im Focus: Greifswalder Forscher dringen mit superauflösendem Mikroskop in zellulären Mikrokosmos ein

Das Institut für Anatomie und Zellbiologie weiht am Montag, 05.12.2016, mit einem wissenschaftlichen Symposium das erste Superresolution-Mikroskop in Greifswald ein. Das Forschungsmikroskop wurde von der Deutschen Forschungsgemeinschaft (DFG) und dem Land Mecklenburg-Vorpommern finanziert. Nun können die Greifswalder Wissenschaftler Strukturen bis zu einer Größe von einigen Millionstel Millimetern mittels Laserlicht sichtbar machen.

Weit über hundert Jahre lang galt die von Ernst Abbe 1873 publizierte Theorie zur Auflösungsgrenze von Lichtmikroskopen als ein in Stein gemeißeltes Gesetz....

Im Focus: Durchbruch in der Diabetesforschung: Pankreaszellen produzieren Insulin durch Malariamedikament

Artemisinine, eine zugelassene Wirkstoffgruppe gegen Malaria, wandelt Glukagon-produzierende Alpha-Zellen der Bauchspeicheldrüse (Pankreas) in insulinproduzierende Zellen um – genau die Zellen, die bei Typ-1-Diabetes geschädigt sind. Das haben Forscher des CeMM Forschungszentrum für Molekulare Medizin der Österreichischen Akademie der Wissenschaften im Rahmen einer internationalen Zusammenarbeit mit modernsten Einzelzell-Analysen herausgefunden. Ihre bahnbrechenden Ergebnisse werden in Cell publiziert und liefern eine vielversprechende Grundlage für neue Therapien gegen Typ-1 Diabetes.

Seit einigen Jahren hatten sich Forscher an diesem Kunstgriff versucht, der eine simple und elegante Heilung des Typ-1 Diabetes versprach: Die vom eigenen...

Im Focus: Makromoleküle: Mit Licht zu Präzisionspolymeren

Chemikern am Karlsruher Institut für Technologie (KIT) ist es gelungen, den Aufbau von Präzisionspolymeren durch lichtgetriebene chemische Reaktionen gezielt zu steuern. Das Verfahren ermöglicht die genaue, geplante Platzierung der Kettengliedern, den Monomeren, entlang von Polymerketten einheitlicher Länge. Die präzise aufgebauten Makromoleküle bilden festgelegte Eigenschaften aus und eignen sich möglicherweise als Informationsspeicher oder synthetische Biomoleküle. Über die neuartige Synthesereaktion berichten die Wissenschaftler nun in der Open Access Publikation Nature Communications. (DOI: 10.1038/NCOMMS13672)

Chemische Reaktionen lassen sich durch Einwirken von Licht bei Zimmertemperatur auslösen. Die Forscher am KIT nutzen diesen Effekt, um unter Licht die...

Alle Focus-News des Innovations-reports >>>

Anzeige

Anzeige

IHR
JOB & KARRIERE
SERVICE
im innovations-report
in Kooperation mit academics
Veranstaltungen

Wie aus reinen Daten ein verständliches Bild entsteht

05.12.2016 | Veranstaltungen

Von „Coopetition“ bis „Digitale Union“ – Die Fertigungsindustrien im digitalen Wandel

02.12.2016 | Veranstaltungen

Experten diskutieren Perspektiven schrumpfender Regionen

01.12.2016 | Veranstaltungen

 
VideoLinks
B2B-VideoLinks
Weitere VideoLinks >>>
Aktuelle Beiträge

Nährstoffhaushalt einer neuentdeckten “Todeszone” im Indischen Ozean auf der Kippe

06.12.2016 | Geowissenschaften

Entschlüsselung von Kommunikationswegen zwischen Tumor- und Immunzellen beim Eierstockkrebs

06.12.2016 | Medizin Gesundheit

Bioabbaubare Polymer-Beschichtung für Implantate

06.12.2016 | Materialwissenschaften