Forum für Wissenschaft, Industrie und Wirtschaft

Hauptsponsoren:     3M 
Datenbankrecherche:

 

Orientierung im Buchstaben-Dschungel der Gene

15.08.2002


Suchmaschine "NGFN-BLAST" erleichtert Vergleich genetischer Daten im Internet

Die frei zugängliche Gen-Suchmaschine "NGFN-BLAST" der Gesellschaft für Biotechnologische Forschung (GBF) erleichtert es jetzt Wissenschaftlern herauszufinden, welche Informationen sich hinter ermittelten genetischen Sequenzen verbergen. Als erster öffentlicher BLAST-Server in Deutschland erlaubt der Dienst den Sequenzvergleich mit speziellen, durch die Nutzergemeinde ausgewählten Untergruppen wie zum Beispiel Mensch, Maus oder Ratte. Der BLAST-Server (BLAST = Basic Local Alignment Search Tool) ist Teil der Forschungsarbeiten der GBF im Nationalen Genomforschungsnetz (NGFN). Mitglieder aus dem NGFN erhalten einen bevorzugten Zugriff zu den Daten und können sich ihr Wunschmenü an Untergruppen zusammenstellen. Eine weitere Besonderheit des Dienstes ist der Verweis auf bereits patentierte Sequenzen. Für die wirtschaftliche Nutzung genetischer Daten ist dieser Service von hoher Bedeutung.

Ähnliche Buchstabenabfolgen in den Gensequenzen weisen oft auf eine Verwandschaft der kodierten Eiweiße hin und erlauben Rückschlüsse auf die Funktion der Gene. Zurzeit gibt es drei öffentliche Gendatenbanken, die Sequenzvergleiche ermöglichen. Deren Daten werden in den USA, Großbritannien und Japan gesammelt und abgeglichen. Eine gezielte Suche ist oft sehr mühsam, da bisher meist die passenden Gensequenzen aller in der Datenbank vorhandenen Organismen aufgelistet werden. Der NGFN-BLAST-Server greift auf diese Daten zurück, aktualisiert sie jedoch täglich, prüft sie auf Unstimmigkeiten und sortiert sie gemäß der gewünschten Untergruppen. Das System ist so flexibel, dass es bei Bedarf um zusätzliche Untergruppen erweitert werden kann. Damit ist der Dienst ein wichtiges Werkzeug, um die Datenberge aus der Genomforschung nicht nur zu sammeln, sondern auch zu interpretieren.

Arbeitsweise des Dienstes: Beispiel Interferon

Gibt man zum Beispiel die Gensequenz "AAAACCTTAAGAAATATTTT" in das Eingabeformular ein und startet dann eine eingeschränkte Suche nach ähnlichen Genabschnitten in Mensch, Maus und Ratte, so zeigt sich, dass es sich bei der Information um einen Teil des gamma-Interferon-Gens handelt. Interferone spielen eine wichtige Rolle bei der Immunantwort. Sie können bestimmte weiße Blutkörperchen so aktivieren, dass sie Bakterien zerstören. Auch bei Virus-Erkrankungen, wie Gelbsucht, hat sich eine Behandlung mit Interferonen bewährt. Die Suche im NGFN-BLAST zeigt zudem, welche Interferone durch Patente geschützt sind. Veränderungen in der eingegebenen Buchstabenfolge oder bei den Suchparametern führen zu anderen Ergebnissen.

Thomas Gazlig | Presseinformation
Weitere Informationen:
http://www.gbf.de/forschung/ngfn/index.html
http://www.gbf.de/
http://www.rzpd.de/ngfn/

Weitere Berichte zu: BLAST-Server Gensequenz Interferon Sequenzvergleich

Weitere Nachrichten aus der Kategorie Biowissenschaften Chemie:

nachricht Akute Myeloische Leukämie: Ulmer erforschen bisher unbekannten Mechanismus der Blutkrebsentstehung
26.04.2017 | Universität Ulm

nachricht Zusammenhang zwischen Immunsystem, Hirnstruktur und Gedächtnis entdeckt
26.04.2017 | Universität Basel

Alle Nachrichten aus der Kategorie: Biowissenschaften Chemie >>>

Die aktuellsten Pressemeldungen zum Suchbegriff Innovation >>>

Die letzten 5 Focus-News des innovations-reports im Überblick:

Im Focus: Weltweit einzigartiger Windkanal im Leipziger Wolkenlabor hat Betrieb aufgenommen

Am Leibniz-Institut für Troposphärenforschung (TROPOS) ist am Dienstag eine weltweit einzigartige Anlage in Betrieb genommen worden, mit der die Einflüsse von Turbulenzen auf Wolkenprozesse unter präzise einstellbaren Versuchsbedingungen untersucht werden können. Der neue Windkanal ist Teil des Leipziger Wolkenlabors, in dem seit 2006 verschiedenste Wolkenprozesse simuliert werden. Unter Laborbedingungen wurden z.B. das Entstehen und Gefrieren von Wolken nachgestellt. Wie stark Luftverwirbelungen diese Prozesse beeinflussen, konnte bisher noch nicht untersucht werden. Deshalb entstand in den letzten Jahren eine ergänzende Anlage für rund eine Million Euro.

Die von dieser Anlage zu erwarteten neuen Erkenntnisse sind wichtig für das Verständnis von Wetter und Klima, wie etwa die Bildung von Niederschlag und die...

Im Focus: Nanoskopie auf dem Chip: Mikroskopie in HD-Qualität

Neue Erfindung der Universitäten Bielefeld und Tromsø (Norwegen)

Physiker der Universität Bielefeld und der norwegischen Universität Tromsø haben einen Chip entwickelt, der super-auflösende Lichtmikroskopie, auch...

Im Focus: Löschbare Tinte für den 3-D-Druck

Im 3-D-Druckverfahren durch Direktes Laserschreiben können Mikrometer-große Strukturen mit genau definierten Eigenschaften geschrieben werden. Forscher des Karlsruher Institus für Technologie (KIT) haben ein Verfahren entwickelt, durch das sich die 3-D-Tinte für die Drucker wieder ‚wegwischen‘ lässt. Die bis zu hundert Nanometer kleinen Strukturen lassen sich dadurch wiederholt auflösen und neu schreiben - ein Nanometer entspricht einem millionstel Millimeter. Die Entwicklung eröffnet der 3-D-Fertigungstechnik vielfältige neue Anwendungen, zum Beispiel in der Biologie oder Materialentwicklung.

Beim Direkten Laserschreiben erzeugt ein computergesteuerter, fokussierter Laserstrahl in einem Fotolack wie ein Stift die Struktur. „Eine Tinte zu entwickeln,...

Im Focus: Leichtbau serientauglich machen

Immer mehr Autobauer setzen auf Karosserieteile aus kohlenstofffaserverstärktem Kunststoff (CFK). Dennoch müssen Fertigungs- und Reparaturkosten weiter gesenkt werden, um CFK kostengünstig nutzbar zu machen. Das Laser Zentrum Hannover e.V. (LZH) hat daher zusammen mit der Volkswagen AG und fünf weiteren Partnern im Projekt HolQueSt 3D Laserprozesse zum automatisierten Besäumen, Bohren und Reparieren von dreidimensionalen Bauteilen entwickelt.

Automatisiert ablaufende Bearbeitungsprozesse sind die Grundlage, um CFK-Bauteile endgültig in die Serienproduktion zu bringen. Ausgerichtet an einem...

Im Focus: Making lightweight construction suitable for series production

More and more automobile companies are focusing on body parts made of carbon fiber reinforced plastics (CFRP). However, manufacturing and repair costs must be further reduced in order to make CFRP more economical in use. Together with the Volkswagen AG and five other partners in the project HolQueSt 3D, the Laser Zentrum Hannover e.V. (LZH) has developed laser processes for the automatic trimming, drilling and repair of three-dimensional components.

Automated manufacturing processes are the basis for ultimately establishing the series production of CFRP components. In the project HolQueSt 3D, the LZH has...

Alle Focus-News des Innovations-reports >>>

Anzeige

Anzeige

IHR
JOB & KARRIERE
SERVICE
im innovations-report
in Kooperation mit academics
Veranstaltungen

Ballungsräume Europas

26.04.2017 | Veranstaltungen

200 Weltneuheiten beim Innovationstag Mittelstand in Berlin

26.04.2017 | Veranstaltungen

123. Internistenkongress: Wie digitale Technik die Patientenversorgung verändert

26.04.2017 | Veranstaltungen

 
VideoLinks
B2B-VideoLinks
Weitere VideoLinks >>>
Aktuelle Beiträge

Akute Myeloische Leukämie: Ulmer erforschen bisher unbekannten Mechanismus der Blutkrebsentstehung

26.04.2017 | Biowissenschaften Chemie

Naturkatastrophen kosten Winzer jährlich Milliarden

26.04.2017 | Interdisziplinäre Forschung

Zusammenhang zwischen Immunsystem, Hirnstruktur und Gedächtnis entdeckt

26.04.2017 | Biowissenschaften Chemie