Forum für Wissenschaft, Industrie und Wirtschaft

Hauptsponsoren:     3M 


Orientierung im Buchstaben-Dschungel der Gene


Suchmaschine "NGFN-BLAST" erleichtert Vergleich genetischer Daten im Internet

Die frei zugängliche Gen-Suchmaschine "NGFN-BLAST" der Gesellschaft für Biotechnologische Forschung (GBF) erleichtert es jetzt Wissenschaftlern herauszufinden, welche Informationen sich hinter ermittelten genetischen Sequenzen verbergen. Als erster öffentlicher BLAST-Server in Deutschland erlaubt der Dienst den Sequenzvergleich mit speziellen, durch die Nutzergemeinde ausgewählten Untergruppen wie zum Beispiel Mensch, Maus oder Ratte. Der BLAST-Server (BLAST = Basic Local Alignment Search Tool) ist Teil der Forschungsarbeiten der GBF im Nationalen Genomforschungsnetz (NGFN). Mitglieder aus dem NGFN erhalten einen bevorzugten Zugriff zu den Daten und können sich ihr Wunschmenü an Untergruppen zusammenstellen. Eine weitere Besonderheit des Dienstes ist der Verweis auf bereits patentierte Sequenzen. Für die wirtschaftliche Nutzung genetischer Daten ist dieser Service von hoher Bedeutung.

Ähnliche Buchstabenabfolgen in den Gensequenzen weisen oft auf eine Verwandschaft der kodierten Eiweiße hin und erlauben Rückschlüsse auf die Funktion der Gene. Zurzeit gibt es drei öffentliche Gendatenbanken, die Sequenzvergleiche ermöglichen. Deren Daten werden in den USA, Großbritannien und Japan gesammelt und abgeglichen. Eine gezielte Suche ist oft sehr mühsam, da bisher meist die passenden Gensequenzen aller in der Datenbank vorhandenen Organismen aufgelistet werden. Der NGFN-BLAST-Server greift auf diese Daten zurück, aktualisiert sie jedoch täglich, prüft sie auf Unstimmigkeiten und sortiert sie gemäß der gewünschten Untergruppen. Das System ist so flexibel, dass es bei Bedarf um zusätzliche Untergruppen erweitert werden kann. Damit ist der Dienst ein wichtiges Werkzeug, um die Datenberge aus der Genomforschung nicht nur zu sammeln, sondern auch zu interpretieren.

Arbeitsweise des Dienstes: Beispiel Interferon

Gibt man zum Beispiel die Gensequenz "AAAACCTTAAGAAATATTTT" in das Eingabeformular ein und startet dann eine eingeschränkte Suche nach ähnlichen Genabschnitten in Mensch, Maus und Ratte, so zeigt sich, dass es sich bei der Information um einen Teil des gamma-Interferon-Gens handelt. Interferone spielen eine wichtige Rolle bei der Immunantwort. Sie können bestimmte weiße Blutkörperchen so aktivieren, dass sie Bakterien zerstören. Auch bei Virus-Erkrankungen, wie Gelbsucht, hat sich eine Behandlung mit Interferonen bewährt. Die Suche im NGFN-BLAST zeigt zudem, welche Interferone durch Patente geschützt sind. Veränderungen in der eingegebenen Buchstabenfolge oder bei den Suchparametern führen zu anderen Ergebnissen.

Thomas Gazlig | Presseinformation
Weitere Informationen:

Weitere Berichte zu: BLAST-Server Gensequenz Interferon Sequenzvergleich

Weitere Nachrichten aus der Kategorie Biowissenschaften Chemie:

nachricht Neues Schiff für die Fischerei- und Meeresforschung
22.03.2017 | Johann Heinrich von Thünen-Institut, Bundesforschungsinstitut für Ländliche Räume, Wald und Fischerei

nachricht Mit voller Kraft auf Erregerjagd
22.03.2017 | Helmholtz-Zentrum für Infektionsforschung

Alle Nachrichten aus der Kategorie: Biowissenschaften Chemie >>>

Die aktuellsten Pressemeldungen zum Suchbegriff Innovation >>>

Die letzten 5 Focus-News des innovations-reports im Überblick:

Im Focus: Gigantische Magnetfelder im Universum

Astronomen aus Bonn und Tautenburg in Thüringen beobachteten mit dem 100-m-Radioteleskop Effelsberg Galaxienhaufen, das sind Ansammlungen von Sternsystemen, heißem Gas und geladenen Teilchen. An den Rändern dieser Galaxienhaufen fanden sie außergewöhnlich geordnete Magnetfelder, die sich über viele Millionen Lichtjahre erstrecken. Sie stellen die größten bekannten Magnetfelder im Universum dar.

Die Ergebnisse werden am 22. März in der Fachzeitschrift „Astronomy & Astrophysics“ veröffentlicht.

Galaxienhaufen sind die größten gravitativ gebundenen Strukturen im Universum, mit einer Ausdehnung von etwa zehn Millionen Lichtjahren. Im Vergleich dazu ist...

Im Focus: Giant Magnetic Fields in the Universe

Astronomers from Bonn and Tautenburg in Thuringia (Germany) used the 100-m radio telescope at Effelsberg to observe several galaxy clusters. At the edges of these large accumulations of dark matter, stellar systems (galaxies), hot gas, and charged particles, they found magnetic fields that are exceptionally ordered over distances of many million light years. This makes them the most extended magnetic fields in the universe known so far.

The results will be published on March 22 in the journal „Astronomy & Astrophysics“.

Galaxy clusters are the largest gravitationally bound structures in the universe. With a typical extent of about 10 million light years, i.e. 100 times the...

Im Focus: Auf der Spur des linearen Ubiquitins

Eine neue Methode ermöglicht es, den Geheimcode linearer Ubiquitin-Ketten zu entschlüsseln. Forscher der Goethe-Universität berichten darüber in der aktuellen Ausgabe von "nature methods", zusammen mit Partnern der Universität Tübingen, der Queen Mary University und des Francis Crick Institute in London.

Ubiquitin ist ein kleines Molekül, das im Körper an andere Proteine angehängt wird und so deren Funktion kontrollieren und verändern kann. Die Anheftung...

Im Focus: Tracing down linear ubiquitination

Researchers at the Goethe University Frankfurt, together with partners from the University of Tübingen in Germany and Queen Mary University as well as Francis Crick Institute from London (UK) have developed a novel technology to decipher the secret ubiquitin code.

Ubiquitin is a small protein that can be linked to other cellular proteins, thereby controlling and modulating their functions. The attachment occurs in many...

Im Focus: Physiker erzeugen gezielt Elektronenwirbel

Einem Team um den Oldenburger Experimentalphysiker Prof. Dr. Matthias Wollenhaupt ist es mithilfe ultrakurzer Laserpulse gelungen, gezielt Elektronenwirbel zu erzeugen und diese dreidimensional abzubilden. Damit haben sie einen komplexen physikalischen Vorgang steuern können: die sogenannte Photoionisation oder Ladungstrennung. Diese gilt als entscheidender Schritt bei der Umwandlung von Licht in elektrischen Strom, beispielsweise in Solarzellen. Die Ergebnisse ihrer experimentellen Arbeit haben die Grundlagenforscher kürzlich in der renommierten Fachzeitschrift „Physical Review Letters“ veröffentlicht.

Das Umwandeln von Licht in elektrischen Strom ist ein ultraschneller Vorgang, dessen Details erstmals Albert Einstein in seinen Studien zum photoelektrischen...

Alle Focus-News des Innovations-reports >>>



im innovations-report
in Kooperation mit academics

Die „Panama Papers“ aus Programmierersicht

22.03.2017 | Veranstaltungen

Über Raum, Zeit und Materie

22.03.2017 | Veranstaltungen

Unter der Haut

22.03.2017 | Veranstaltungen

Weitere VideoLinks >>>
Aktuelle Beiträge

Die „Panama Papers“ aus Programmierersicht

22.03.2017 | Veranstaltungsnachrichten

Neues Schiff für die Fischerei- und Meeresforschung

22.03.2017 | Biowissenschaften Chemie

Mit voller Kraft auf Erregerjagd

22.03.2017 | Biowissenschaften Chemie