Forum für Wissenschaft, Industrie und Wirtschaft

Hauptsponsoren:     3M 
Datenbankrecherche:

 

Orientierung im Buchstaben-Dschungel der Gene

15.08.2002


Suchmaschine "NGFN-BLAST" erleichtert Vergleich genetischer Daten im Internet

Die frei zugängliche Gen-Suchmaschine "NGFN-BLAST" der Gesellschaft für Biotechnologische Forschung (GBF) erleichtert es jetzt Wissenschaftlern herauszufinden, welche Informationen sich hinter ermittelten genetischen Sequenzen verbergen. Als erster öffentlicher BLAST-Server in Deutschland erlaubt der Dienst den Sequenzvergleich mit speziellen, durch die Nutzergemeinde ausgewählten Untergruppen wie zum Beispiel Mensch, Maus oder Ratte. Der BLAST-Server (BLAST = Basic Local Alignment Search Tool) ist Teil der Forschungsarbeiten der GBF im Nationalen Genomforschungsnetz (NGFN). Mitglieder aus dem NGFN erhalten einen bevorzugten Zugriff zu den Daten und können sich ihr Wunschmenü an Untergruppen zusammenstellen. Eine weitere Besonderheit des Dienstes ist der Verweis auf bereits patentierte Sequenzen. Für die wirtschaftliche Nutzung genetischer Daten ist dieser Service von hoher Bedeutung.

Ähnliche Buchstabenabfolgen in den Gensequenzen weisen oft auf eine Verwandschaft der kodierten Eiweiße hin und erlauben Rückschlüsse auf die Funktion der Gene. Zurzeit gibt es drei öffentliche Gendatenbanken, die Sequenzvergleiche ermöglichen. Deren Daten werden in den USA, Großbritannien und Japan gesammelt und abgeglichen. Eine gezielte Suche ist oft sehr mühsam, da bisher meist die passenden Gensequenzen aller in der Datenbank vorhandenen Organismen aufgelistet werden. Der NGFN-BLAST-Server greift auf diese Daten zurück, aktualisiert sie jedoch täglich, prüft sie auf Unstimmigkeiten und sortiert sie gemäß der gewünschten Untergruppen. Das System ist so flexibel, dass es bei Bedarf um zusätzliche Untergruppen erweitert werden kann. Damit ist der Dienst ein wichtiges Werkzeug, um die Datenberge aus der Genomforschung nicht nur zu sammeln, sondern auch zu interpretieren.

Arbeitsweise des Dienstes: Beispiel Interferon

Gibt man zum Beispiel die Gensequenz "AAAACCTTAAGAAATATTTT" in das Eingabeformular ein und startet dann eine eingeschränkte Suche nach ähnlichen Genabschnitten in Mensch, Maus und Ratte, so zeigt sich, dass es sich bei der Information um einen Teil des gamma-Interferon-Gens handelt. Interferone spielen eine wichtige Rolle bei der Immunantwort. Sie können bestimmte weiße Blutkörperchen so aktivieren, dass sie Bakterien zerstören. Auch bei Virus-Erkrankungen, wie Gelbsucht, hat sich eine Behandlung mit Interferonen bewährt. Die Suche im NGFN-BLAST zeigt zudem, welche Interferone durch Patente geschützt sind. Veränderungen in der eingegebenen Buchstabenfolge oder bei den Suchparametern führen zu anderen Ergebnissen.

Thomas Gazlig | Presseinformation
Weitere Informationen:
http://www.gbf.de/forschung/ngfn/index.html
http://www.gbf.de/
http://www.rzpd.de/ngfn/

Weitere Berichte zu: BLAST-Server Gensequenz Interferon Sequenzvergleich

Weitere Nachrichten aus der Kategorie Biowissenschaften Chemie:

nachricht Salmonellen als Medikament gegen Tumore
23.10.2017 | Helmholtz-Zentrum für Infektionsforschung

nachricht Add-ons: Was Computerprogramme und Proteine gemeinsam haben
23.10.2017 | Universität Regensburg

Alle Nachrichten aus der Kategorie: Biowissenschaften Chemie >>>

Die aktuellsten Pressemeldungen zum Suchbegriff Innovation >>>

Die letzten 5 Focus-News des innovations-reports im Überblick:

Im Focus: Salmonellen als Medikament gegen Tumore

HZI-Forscher entwickeln Bakterienstamm, der in der Krebstherapie eingesetzt werden kann

Salmonellen sind gefährliche Krankheitserreger, die über verdorbene Lebensmittel in den Körper gelangen und schwere Infektionen verursachen können. Jedoch ist...

Im Focus: Salmonella as a tumour medication

HZI researchers developed a bacterial strain that can be used in cancer therapy

Salmonellae are dangerous pathogens that enter the body via contaminated food and can cause severe infections. But these bacteria are also known to target...

Im Focus: Hochfeldmagnet am BER II: Einblick in eine versteckte Ordnung

Seit dreißig Jahren gibt eine bestimmte Uranverbindung der Forschung Rätsel auf. Obwohl die Kristallstruktur einfach ist, versteht niemand, was beim Abkühlen unter eine bestimmte Temperatur genau passiert. Offenbar entsteht eine so genannte „versteckte Ordnung“, deren Natur völlig unklar ist. Nun haben Physiker erstmals diese versteckte Ordnung näher charakterisiert und auf mikroskopischer Skala untersucht. Dazu nutzten sie den Hochfeldmagneten am HZB, der Neutronenexperimente unter extrem hohen magnetischen Feldern ermöglicht.

Kristalle aus den Elementen Uran, Ruthenium, Rhodium und Silizium haben eine geometrisch einfache Struktur und sollten keine Geheimnisse mehr bergen. Doch das...

Im Focus: Schmetterlingsflügel inspiriert Photovoltaik: Absorption lässt sich um bis zu 200 Prozent steigern

Sonnenlicht, das von Solarzellen reflektiert wird, geht als ungenutzte Energie verloren. Die Flügel des Schmetterlings „Gewöhnliche Rose“ (Pachliopta aristolochiae) zeichnen sich durch Nanostrukturen aus, kleinste Löcher, die Licht über ein breites Spektrum deutlich besser absorbieren als glatte Oberflächen. Forschern am Karlsruher Institut für Technologie (KIT) ist es nun gelungen, diese Nanostrukturen auf Solarzellen zu übertragen und deren Licht-Absorptionsrate so um bis zu 200 Prozent zu steigern. Ihre Ergebnisse veröffentlichten die Wissenschaftler nun im Fachmagazin Science Advances. DOI: 10.1126/sciadv.1700232

„Der von uns untersuchte Schmetterling hat eine augenscheinliche Besonderheit: Er ist extrem dunkelschwarz. Das liegt daran, dass er für eine optimale...

Im Focus: Schnelle individualisierte Therapiewahl durch Sortierung von Biomolekülen und Zellen mit Licht

Im Blut zirkulierende Biomoleküle und Zellen sind Träger diagnostischer Information, deren Analyse hochwirksame, individuelle Therapien ermöglichen. Um diese Information zu erschließen, haben Wissenschaftler des Fraunhofer-Instituts für Lasertechnik ILT ein Mikrochip-basiertes Diagnosegerät entwickelt: Der »AnaLighter« analysiert und sortiert klinisch relevante Biomoleküle und Zellen in einer Blutprobe mit Licht. Dadurch können Frühdiagnosen beispielsweise von Tumor- sowie Herz-Kreislauf-Erkrankungen gestellt und patientenindividuelle Therapien eingeleitet werden. Experten des Fraunhofer ILT stellen diese Technologie vom 13.–16. November auf der COMPAMED 2017 in Düsseldorf vor.

Der »AnaLighter« ist ein kompaktes Diagnosegerät zum Sortieren von Zellen und Biomolekülen. Sein technologischer Kern basiert auf einem optisch schaltbaren...

Alle Focus-News des Innovations-reports >>>

Anzeige

Anzeige

IHR
JOB & KARRIERE
SERVICE
im innovations-report
in Kooperation mit academics
Veranstaltungen

Konferenz IT-Security Community Xchange (IT-SECX) am 10. November 2017

23.10.2017 | Veranstaltungen

Die Zukunft der Luftfracht

23.10.2017 | Veranstaltungen

Ehrung des Autors Herbert W. Franke mit dem Kurd-Laßwitz-Sonderpreis 2017

23.10.2017 | Veranstaltungen

 
VideoLinks
B2B-VideoLinks
Weitere VideoLinks >>>
Aktuelle Beiträge

Magma sucht sich nach Flankenkollaps neue Wege

23.10.2017 | Geowissenschaften

Neues Sensorsystem sorgt für sichere Ernte

23.10.2017 | Informationstechnologie

Salmonellen als Medikament gegen Tumore

23.10.2017 | Biowissenschaften Chemie