Forum für Wissenschaft, Industrie und Wirtschaft

Hauptsponsoren:     3M 
Datenbankrecherche:

 

Orientierung im Buchstaben-Dschungel der Gene

15.08.2002


Suchmaschine "NGFN-BLAST" erleichtert Vergleich genetischer Daten im Internet

Die frei zugängliche Gen-Suchmaschine "NGFN-BLAST" der Gesellschaft für Biotechnologische Forschung (GBF) erleichtert es jetzt Wissenschaftlern herauszufinden, welche Informationen sich hinter ermittelten genetischen Sequenzen verbergen. Als erster öffentlicher BLAST-Server in Deutschland erlaubt der Dienst den Sequenzvergleich mit speziellen, durch die Nutzergemeinde ausgewählten Untergruppen wie zum Beispiel Mensch, Maus oder Ratte. Der BLAST-Server (BLAST = Basic Local Alignment Search Tool) ist Teil der Forschungsarbeiten der GBF im Nationalen Genomforschungsnetz (NGFN). Mitglieder aus dem NGFN erhalten einen bevorzugten Zugriff zu den Daten und können sich ihr Wunschmenü an Untergruppen zusammenstellen. Eine weitere Besonderheit des Dienstes ist der Verweis auf bereits patentierte Sequenzen. Für die wirtschaftliche Nutzung genetischer Daten ist dieser Service von hoher Bedeutung.

Ähnliche Buchstabenabfolgen in den Gensequenzen weisen oft auf eine Verwandschaft der kodierten Eiweiße hin und erlauben Rückschlüsse auf die Funktion der Gene. Zurzeit gibt es drei öffentliche Gendatenbanken, die Sequenzvergleiche ermöglichen. Deren Daten werden in den USA, Großbritannien und Japan gesammelt und abgeglichen. Eine gezielte Suche ist oft sehr mühsam, da bisher meist die passenden Gensequenzen aller in der Datenbank vorhandenen Organismen aufgelistet werden. Der NGFN-BLAST-Server greift auf diese Daten zurück, aktualisiert sie jedoch täglich, prüft sie auf Unstimmigkeiten und sortiert sie gemäß der gewünschten Untergruppen. Das System ist so flexibel, dass es bei Bedarf um zusätzliche Untergruppen erweitert werden kann. Damit ist der Dienst ein wichtiges Werkzeug, um die Datenberge aus der Genomforschung nicht nur zu sammeln, sondern auch zu interpretieren.

Arbeitsweise des Dienstes: Beispiel Interferon

Gibt man zum Beispiel die Gensequenz "AAAACCTTAAGAAATATTTT" in das Eingabeformular ein und startet dann eine eingeschränkte Suche nach ähnlichen Genabschnitten in Mensch, Maus und Ratte, so zeigt sich, dass es sich bei der Information um einen Teil des gamma-Interferon-Gens handelt. Interferone spielen eine wichtige Rolle bei der Immunantwort. Sie können bestimmte weiße Blutkörperchen so aktivieren, dass sie Bakterien zerstören. Auch bei Virus-Erkrankungen, wie Gelbsucht, hat sich eine Behandlung mit Interferonen bewährt. Die Suche im NGFN-BLAST zeigt zudem, welche Interferone durch Patente geschützt sind. Veränderungen in der eingegebenen Buchstabenfolge oder bei den Suchparametern führen zu anderen Ergebnissen.

Thomas Gazlig | Presseinformation
Weitere Informationen:
http://www.gbf.de/forschung/ngfn/index.html
http://www.gbf.de/
http://www.rzpd.de/ngfn/

Weitere Berichte zu: BLAST-Server Gensequenz Interferon Sequenzvergleich

Weitere Nachrichten aus der Kategorie Biowissenschaften Chemie:

nachricht 'Fix Me Another Marguerite!'
23.06.2017 | Universität Regensburg

nachricht Schimpansen belohnen Gefälligkeiten
23.06.2017 | Max-Planck-Institut für Mathematik in den Naturwissenschaften (MPIMIS)

Alle Nachrichten aus der Kategorie: Biowissenschaften Chemie >>>

Die aktuellsten Pressemeldungen zum Suchbegriff Innovation >>>

Die letzten 5 Focus-News des innovations-reports im Überblick:

Im Focus: Can we see monkeys from space? Emerging technologies to map biodiversity

An international team of scientists has proposed a new multi-disciplinary approach in which an array of new technologies will allow us to map biodiversity and the risks that wildlife is facing at the scale of whole landscapes. The findings are published in Nature Ecology and Evolution. This international research is led by the Kunming Institute of Zoology from China, University of East Anglia, University of Leicester and the Leibniz Institute for Zoo and Wildlife Research.

Using a combination of satellite and ground data, the team proposes that it is now possible to map biodiversity with an accuracy that has not been previously...

Im Focus: Klima-Satellit: Mit robuster Lasertechnik Methan auf der Spur

Hitzewellen in der Arktis, längere Vegetationsperioden in Europa, schwere Überschwemmungen in Westafrika – mit Hilfe des deutsch-französischen Satelliten MERLIN wollen Wissenschaftler ab 2021 die Emissionen des Treibhausgases Methan auf der Erde erforschen. Möglich macht das ein neues robustes Lasersystem des Fraunhofer-Instituts für Lasertechnologie ILT in Aachen, das eine bisher unerreichte Messgenauigkeit erzielt.

Methan entsteht unter anderem bei Fäulnisprozessen. Es ist 25-mal wirksamer als das klimaschädliche Kohlendioxid, kommt in der Erdatmosphäre aber lange nicht...

Im Focus: Climate satellite: Tracking methane with robust laser technology

Heatwaves in the Arctic, longer periods of vegetation in Europe, severe floods in West Africa – starting in 2021, scientists want to explore the emissions of the greenhouse gas methane with the German-French satellite MERLIN. This is made possible by a new robust laser system of the Fraunhofer Institute for Laser Technology ILT in Aachen, which achieves unprecedented measurement accuracy.

Methane is primarily the result of the decomposition of organic matter. The gas has a 25 times greater warming potential than carbon dioxide, but is not as...

Im Focus: How protons move through a fuel cell

Hydrogen is regarded as the energy source of the future: It is produced with solar power and can be used to generate heat and electricity in fuel cells. Empa researchers have now succeeded in decoding the movement of hydrogen ions in crystals – a key step towards more efficient energy conversion in the hydrogen industry of tomorrow.

As charge carriers, electrons and ions play the leading role in electrochemical energy storage devices and converters such as batteries and fuel cells. Proton...

Im Focus: Die Schweiz in Pole-Position in der neuen ESA-Mission

Die Europäische Weltraumagentur ESA gab heute grünes Licht für die industrielle Produktion von PLATO, der grössten europäischen wissenschaftlichen Mission zu Exoplaneten. Partner dieser Mission sind die Universitäten Bern und Genf.

Die Europäische Weltraumagentur ESA lanciert heute PLATO (PLAnetary Transits and Oscillation of stars), die grösste europäische wissenschaftliche Mission zur...

Alle Focus-News des Innovations-reports >>>

Anzeige

Anzeige

IHR
JOB & KARRIERE
SERVICE
im innovations-report
in Kooperation mit academics
Veranstaltungen

Von Batterieforschung bis Optoelektronik

23.06.2017 | Veranstaltungen

10. HDT-Tagung: Elektrische Antriebstechnologie für Hybrid- und Elektrofahrzeuge

22.06.2017 | Veranstaltungen

„Fit für die Industrie 4.0“ – Tagung von Hochschule Darmstadt und Schader-Stiftung am 27. Juni

22.06.2017 | Veranstaltungen

 
VideoLinks
B2B-VideoLinks
Weitere VideoLinks >>>
Aktuelle Beiträge

Radioaktive Elemente in Cassiopeia A liefern Hinweise auf Neutrinos als Ursache der Supernova-Explosion

23.06.2017 | Physik Astronomie

Dünenökosysteme modellieren

23.06.2017 | Ökologie Umwelt- Naturschutz

Makro-Mikrowelle macht Leichtbau für Luft- und Raumfahrt effizienter

23.06.2017 | Materialwissenschaften