Forum für Wissenschaft, Industrie und Wirtschaft

Hauptsponsoren:     3M 
Datenbankrecherche:

 

Orientierung im Buchstaben-Dschungel der Gene

15.08.2002


Suchmaschine "NGFN-BLAST" erleichtert Vergleich genetischer Daten im Internet

Die frei zugängliche Gen-Suchmaschine "NGFN-BLAST" der Gesellschaft für Biotechnologische Forschung (GBF) erleichtert es jetzt Wissenschaftlern herauszufinden, welche Informationen sich hinter ermittelten genetischen Sequenzen verbergen. Als erster öffentlicher BLAST-Server in Deutschland erlaubt der Dienst den Sequenzvergleich mit speziellen, durch die Nutzergemeinde ausgewählten Untergruppen wie zum Beispiel Mensch, Maus oder Ratte. Der BLAST-Server (BLAST = Basic Local Alignment Search Tool) ist Teil der Forschungsarbeiten der GBF im Nationalen Genomforschungsnetz (NGFN). Mitglieder aus dem NGFN erhalten einen bevorzugten Zugriff zu den Daten und können sich ihr Wunschmenü an Untergruppen zusammenstellen. Eine weitere Besonderheit des Dienstes ist der Verweis auf bereits patentierte Sequenzen. Für die wirtschaftliche Nutzung genetischer Daten ist dieser Service von hoher Bedeutung.

Ähnliche Buchstabenabfolgen in den Gensequenzen weisen oft auf eine Verwandschaft der kodierten Eiweiße hin und erlauben Rückschlüsse auf die Funktion der Gene. Zurzeit gibt es drei öffentliche Gendatenbanken, die Sequenzvergleiche ermöglichen. Deren Daten werden in den USA, Großbritannien und Japan gesammelt und abgeglichen. Eine gezielte Suche ist oft sehr mühsam, da bisher meist die passenden Gensequenzen aller in der Datenbank vorhandenen Organismen aufgelistet werden. Der NGFN-BLAST-Server greift auf diese Daten zurück, aktualisiert sie jedoch täglich, prüft sie auf Unstimmigkeiten und sortiert sie gemäß der gewünschten Untergruppen. Das System ist so flexibel, dass es bei Bedarf um zusätzliche Untergruppen erweitert werden kann. Damit ist der Dienst ein wichtiges Werkzeug, um die Datenberge aus der Genomforschung nicht nur zu sammeln, sondern auch zu interpretieren.

Arbeitsweise des Dienstes: Beispiel Interferon

Gibt man zum Beispiel die Gensequenz "AAAACCTTAAGAAATATTTT" in das Eingabeformular ein und startet dann eine eingeschränkte Suche nach ähnlichen Genabschnitten in Mensch, Maus und Ratte, so zeigt sich, dass es sich bei der Information um einen Teil des gamma-Interferon-Gens handelt. Interferone spielen eine wichtige Rolle bei der Immunantwort. Sie können bestimmte weiße Blutkörperchen so aktivieren, dass sie Bakterien zerstören. Auch bei Virus-Erkrankungen, wie Gelbsucht, hat sich eine Behandlung mit Interferonen bewährt. Die Suche im NGFN-BLAST zeigt zudem, welche Interferone durch Patente geschützt sind. Veränderungen in der eingegebenen Buchstabenfolge oder bei den Suchparametern führen zu anderen Ergebnissen.

Thomas Gazlig | Presseinformation
Weitere Informationen:
http://www.gbf.de/forschung/ngfn/index.html
http://www.gbf.de/
http://www.rzpd.de/ngfn/

Weitere Berichte zu: BLAST-Server Gensequenz Interferon Sequenzvergleich

Weitere Nachrichten aus der Kategorie Biowissenschaften Chemie:

nachricht In Hochleistungs-Mais sind mehr Gene aktiv
19.01.2018 | Rheinische Friedrich-Wilhelms-Universität Bonn

nachricht Warum es für Pflanzen gut sein kann auf Sex zu verzichten
19.01.2018 | Universität Wien

Alle Nachrichten aus der Kategorie: Biowissenschaften Chemie >>>

Die aktuellsten Pressemeldungen zum Suchbegriff Innovation >>>

Die letzten 5 Focus-News des innovations-reports im Überblick:

Im Focus: Maschinelles Lernen im Quantenlabor

Auf dem Weg zum intelligenten Labor präsentieren Physiker der Universitäten Innsbruck und Wien ein lernfähiges Programm, das eigenständig Quantenexperimente entwirft. In ersten Versuchen hat das System selbständig experimentelle Techniken (wieder)entdeckt, die heute in modernen quantenoptischen Labors Standard sind. Dies zeigt, dass Maschinen in Zukunft auch eine kreativ unterstützende Rolle in der Forschung einnehmen könnten.

In unseren Taschen stecken Smartphones, auf den Straßen fahren intelligente Autos, Experimente im Forschungslabor aber werden immer noch ausschließlich von...

Im Focus: Artificial agent designs quantum experiments

On the way to an intelligent laboratory, physicists from Innsbruck and Vienna present an artificial agent that autonomously designs quantum experiments. In initial experiments, the system has independently (re)discovered experimental techniques that are nowadays standard in modern quantum optical laboratories. This shows how machines could play a more creative role in research in the future.

We carry smartphones in our pockets, the streets are dotted with semi-autonomous cars, but in the research laboratory experiments are still being designed by...

Im Focus: Fliegen wird smarter – Kommunikationssystem LYRA im Lufthansa FlyingLab

• Prototypen-Test im Lufthansa FlyingLab
• LYRA Connect ist eine von drei ausgewählten Innovationen
• Bessere Kommunikation zwischen Kabinencrew und Passagieren

Die Zukunft des Fliegens beginnt jetzt: Mehrere Monate haben die Finalisten des Mode- und Technologiewettbewerbs „Telekom Fashion Fusion & Lufthansa FlyingLab“...

Im Focus: Ein Atom dünn: Physiker messen erstmals mechanische Eigenschaften zweidimensionaler Materialien

Die dünnsten heute herstellbaren Materialien haben eine Dicke von einem Atom. Sie zeigen völlig neue Eigenschaften und sind zweidimensional – bisher bekannte Materialien sind dreidimensional aufgebaut. Um sie herstellen und handhaben zu können, liegen sie bislang als Film auf dreidimensionalen Materialien auf. Erstmals ist es Physikern der Universität des Saarlandes um Uwe Hartmann jetzt mit Forschern vom Leibniz-Institut für Neue Materialien gelungen, die mechanischen Eigenschaften von freitragenden Membranen atomar dünner Materialien zu charakterisieren. Die Messungen erfolgten mit dem Rastertunnelmikroskop an Graphen. Ihre Ergebnisse veröffentlichen die Forscher im Fachmagazin Nanoscale.

Zweidimensionale Materialien sind erst seit wenigen Jahren bekannt. Die Wissenschaftler André Geim und Konstantin Novoselov erhielten im Jahr 2010 den...

Im Focus: Forscher entschlüsseln zentrales Reaktionsprinzip von Metalloenzymen

Sogenannte vorverspannte Zustände beschleunigen auch photochemische Reaktionen

Was ermöglicht den schnellen Transfer von Elektronen, beispielsweise in der Photosynthese? Ein interdisziplinäres Forscherteam hat die Funktionsweise wichtiger...

Alle Focus-News des Innovations-reports >>>

Anzeige

Anzeige

IHR
JOB & KARRIERE
SERVICE
im innovations-report
in Kooperation mit academics
Veranstaltungen

Kongress Meditation und Wissenschaft

19.01.2018 | Veranstaltungen

LED Produktentwicklung – Leuchten mit aktuellem Wissen

18.01.2018 | Veranstaltungen

6. Technologie- und Anwendungsdialog am 18. Januar 2018 an der TH Wildau: „Intelligente Logistik“

18.01.2018 | Veranstaltungen

 
VideoLinks
B2B-VideoLinks
Weitere VideoLinks >>>
Aktuelle Beiträge

Rittal vereinbart mit dem Betriebsrat von RWG Sozialplan - Zukunftsorientierter Dialog führt zur Einigkeit

19.01.2018 | Unternehmensmeldung

Open Science auf offener See

19.01.2018 | Geowissenschaften

Original bleibt Original - Neues Produktschutzverfahren für KFZ-Kennzeichenschilder

19.01.2018 | Informationstechnologie