Forum für Wissenschaft, Industrie und Wirtschaft

Hauptsponsoren:     3M 
Datenbankrecherche:

 

Orientierung im Buchstaben-Dschungel der Gene

15.08.2002


Suchmaschine "NGFN-BLAST" erleichtert Vergleich genetischer Daten im Internet

Die frei zugängliche Gen-Suchmaschine "NGFN-BLAST" der Gesellschaft für Biotechnologische Forschung (GBF) erleichtert es jetzt Wissenschaftlern herauszufinden, welche Informationen sich hinter ermittelten genetischen Sequenzen verbergen. Als erster öffentlicher BLAST-Server in Deutschland erlaubt der Dienst den Sequenzvergleich mit speziellen, durch die Nutzergemeinde ausgewählten Untergruppen wie zum Beispiel Mensch, Maus oder Ratte. Der BLAST-Server (BLAST = Basic Local Alignment Search Tool) ist Teil der Forschungsarbeiten der GBF im Nationalen Genomforschungsnetz (NGFN). Mitglieder aus dem NGFN erhalten einen bevorzugten Zugriff zu den Daten und können sich ihr Wunschmenü an Untergruppen zusammenstellen. Eine weitere Besonderheit des Dienstes ist der Verweis auf bereits patentierte Sequenzen. Für die wirtschaftliche Nutzung genetischer Daten ist dieser Service von hoher Bedeutung.

Ähnliche Buchstabenabfolgen in den Gensequenzen weisen oft auf eine Verwandschaft der kodierten Eiweiße hin und erlauben Rückschlüsse auf die Funktion der Gene. Zurzeit gibt es drei öffentliche Gendatenbanken, die Sequenzvergleiche ermöglichen. Deren Daten werden in den USA, Großbritannien und Japan gesammelt und abgeglichen. Eine gezielte Suche ist oft sehr mühsam, da bisher meist die passenden Gensequenzen aller in der Datenbank vorhandenen Organismen aufgelistet werden. Der NGFN-BLAST-Server greift auf diese Daten zurück, aktualisiert sie jedoch täglich, prüft sie auf Unstimmigkeiten und sortiert sie gemäß der gewünschten Untergruppen. Das System ist so flexibel, dass es bei Bedarf um zusätzliche Untergruppen erweitert werden kann. Damit ist der Dienst ein wichtiges Werkzeug, um die Datenberge aus der Genomforschung nicht nur zu sammeln, sondern auch zu interpretieren.

Arbeitsweise des Dienstes: Beispiel Interferon

Gibt man zum Beispiel die Gensequenz "AAAACCTTAAGAAATATTTT" in das Eingabeformular ein und startet dann eine eingeschränkte Suche nach ähnlichen Genabschnitten in Mensch, Maus und Ratte, so zeigt sich, dass es sich bei der Information um einen Teil des gamma-Interferon-Gens handelt. Interferone spielen eine wichtige Rolle bei der Immunantwort. Sie können bestimmte weiße Blutkörperchen so aktivieren, dass sie Bakterien zerstören. Auch bei Virus-Erkrankungen, wie Gelbsucht, hat sich eine Behandlung mit Interferonen bewährt. Die Suche im NGFN-BLAST zeigt zudem, welche Interferone durch Patente geschützt sind. Veränderungen in der eingegebenen Buchstabenfolge oder bei den Suchparametern führen zu anderen Ergebnissen.

Thomas Gazlig | Presseinformation
Weitere Informationen:
http://www.gbf.de/forschung/ngfn/index.html
http://www.gbf.de/
http://www.rzpd.de/ngfn/

Weitere Berichte zu: BLAST-Server Gensequenz Interferon Sequenzvergleich

Weitere Nachrichten aus der Kategorie Biowissenschaften Chemie:

nachricht Feinstaub weckt schlafende Viren in der Lunge
16.01.2017 | Helmholtz Zentrum München - Deutsches Forschungszentrum für Gesundheit und Umwelt

nachricht Wie Weißbüschelaffen ihr „Babysprech“ ablegen
16.01.2017 | Eberhard Karls Universität Tübingen

Alle Nachrichten aus der Kategorie: Biowissenschaften Chemie >>>

Die aktuellsten Pressemeldungen zum Suchbegriff Innovation >>>

Die letzten 5 Focus-News des innovations-reports im Überblick:

Im Focus: Mit solaren Gebäudehüllen Architektur gestalten

Solarthermie ist in der breiten Öffentlichkeit derzeit durch dunkelblaue, rechteckige Kollektoren auf Hausdächern besetzt. Für ästhetisch hochwertige Architektur werden Technologien benötigt, die dem Architekten mehr Gestaltungsspielraum für Niedrigst- und Plusenergiegebäude geben. Im Projekt »ArKol« entwickeln Forscher des Fraunhofer ISE gemeinsam mit Partnern aktuell zwei Fassadenkollektoren für solare Wärmeerzeugung, die ein hohes Maß an Designflexibilität erlauben: einen Streifenkollektor für opake sowie eine solarthermische Jalousie für transparente Fassadenanteile. Der aktuelle Stand der beiden Entwicklungen wird auf der BAU 2017 vorgestellt.

Im Projekt »ArKol – Entwicklung von architektonisch hoch integrierten Fassadekollektoren mit Heat Pipes« entwickelt das Fraunhofer ISE gemeinsam mit Partnern...

Im Focus: Designing Architecture with Solar Building Envelopes

Among the general public, solar thermal energy is currently associated with dark blue, rectangular collectors on building roofs. Technologies are needed for aesthetically high quality architecture which offer the architect more room for manoeuvre when it comes to low- and plus-energy buildings. With the “ArKol” project, researchers at Fraunhofer ISE together with partners are currently developing two façade collectors for solar thermal energy generation, which permit a high degree of design flexibility: a strip collector for opaque façade sections and a solar thermal blind for transparent sections. The current state of the two developments will be presented at the BAU 2017 trade fair.

As part of the “ArKol – development of architecturally highly integrated façade collectors with heat pipes” project, Fraunhofer ISE together with its partners...

Im Focus: Mit Bindfaden und Schere - die Chromosomenverteilung in der Meiose

Was einmal fest verbunden war sollte nicht getrennt werden? Nicht so in der Meiose, der Zellteilung in der Gameten, Spermien und Eizellen entstehen. Am Anfang der Meiose hält der ringförmige Proteinkomplex Kohäsin die Chromosomenstränge, auf denen die Bauanleitung des Körpers gespeichert ist, zusammen wie ein Bindfaden. Damit am Ende jede Eizelle und jedes Spermium nur einen Chromosomensatz erhält, müssen die Bindfäden aufgeschnitten werden. Forscher vom Max-Planck-Institut für Biochemie zeigen in der Bäckerhefe wie ein auch im Menschen vorkommendes Kinase-Enzym das Aufschneiden der Kohäsinringe kontrolliert und mit dem Austritt aus der Meiose und der Gametenbildung koordiniert.

Warum sehen Kinder eigentlich ihren Eltern ähnlich? Die meisten Zellen unseres Körpers sind diploid, d.h. sie besitzen zwei Kopien von jedem Chromosom – eine...

Im Focus: Der Klang des Ozeans

Umfassende Langzeitstudie zur Geräuschkulisse im Südpolarmeer veröffentlicht

Fast drei Jahre lang haben AWI-Wissenschaftler mit Unterwasser-Mikrofonen in das Südpolarmeer hineingehorcht und einen „Chor“ aus Walen und Robben vernommen....

Im Focus: Wie man eine 80t schwere Betonschale aufbläst

An der TU Wien wurde eine Alternative zu teuren und aufwendigen Schalungen für Kuppelbauten entwickelt, die nun in einem Testbauwerk für die ÖBB-Infrastruktur umgesetzt wird.

Die Schalung für Kuppelbauten aus Beton ist normalerweise aufwändig und teuer. Eine mögliche kostengünstige und ressourcenschonende Alternative bietet die an...

Alle Focus-News des Innovations-reports >>>

Anzeige

Anzeige

IHR
JOB & KARRIERE
SERVICE
im innovations-report
in Kooperation mit academics
Veranstaltungen

Aquakulturen und Fangquoten – was hilft gegen Überfischung?

16.01.2017 | Veranstaltungen

14. BF21-Jahrestagung „Mobilität & Kfz-Versicherung im Fokus“

12.01.2017 | Veranstaltungen

Leipziger Biogas-Fachgespräch lädt zum "Branchengespräch Biogas2020+" nach Nossen

11.01.2017 | Veranstaltungen

 
VideoLinks
B2B-VideoLinks
Weitere VideoLinks >>>
Aktuelle Beiträge

Aquakulturen und Fangquoten – was hilft gegen Überfischung?

16.01.2017 | Veranstaltungsnachrichten

Mit solaren Gebäudehüllen Architektur gestalten

16.01.2017 | Architektur Bauwesen

Herzforschung - Neue Katheterklappe in Tübingen entwickelt

16.01.2017 | Medizintechnik