Forum für Wissenschaft, Industrie und Wirtschaft

Hauptsponsoren:     3M 
Datenbankrecherche:

 

Orientierung im Buchstaben-Dschungel der Gene

15.08.2002


Suchmaschine "NGFN-BLAST" erleichtert Vergleich genetischer Daten im Internet

Die frei zugängliche Gen-Suchmaschine "NGFN-BLAST" der Gesellschaft für Biotechnologische Forschung (GBF) erleichtert es jetzt Wissenschaftlern herauszufinden, welche Informationen sich hinter ermittelten genetischen Sequenzen verbergen. Als erster öffentlicher BLAST-Server in Deutschland erlaubt der Dienst den Sequenzvergleich mit speziellen, durch die Nutzergemeinde ausgewählten Untergruppen wie zum Beispiel Mensch, Maus oder Ratte. Der BLAST-Server (BLAST = Basic Local Alignment Search Tool) ist Teil der Forschungsarbeiten der GBF im Nationalen Genomforschungsnetz (NGFN). Mitglieder aus dem NGFN erhalten einen bevorzugten Zugriff zu den Daten und können sich ihr Wunschmenü an Untergruppen zusammenstellen. Eine weitere Besonderheit des Dienstes ist der Verweis auf bereits patentierte Sequenzen. Für die wirtschaftliche Nutzung genetischer Daten ist dieser Service von hoher Bedeutung.

Ähnliche Buchstabenabfolgen in den Gensequenzen weisen oft auf eine Verwandschaft der kodierten Eiweiße hin und erlauben Rückschlüsse auf die Funktion der Gene. Zurzeit gibt es drei öffentliche Gendatenbanken, die Sequenzvergleiche ermöglichen. Deren Daten werden in den USA, Großbritannien und Japan gesammelt und abgeglichen. Eine gezielte Suche ist oft sehr mühsam, da bisher meist die passenden Gensequenzen aller in der Datenbank vorhandenen Organismen aufgelistet werden. Der NGFN-BLAST-Server greift auf diese Daten zurück, aktualisiert sie jedoch täglich, prüft sie auf Unstimmigkeiten und sortiert sie gemäß der gewünschten Untergruppen. Das System ist so flexibel, dass es bei Bedarf um zusätzliche Untergruppen erweitert werden kann. Damit ist der Dienst ein wichtiges Werkzeug, um die Datenberge aus der Genomforschung nicht nur zu sammeln, sondern auch zu interpretieren.

Arbeitsweise des Dienstes: Beispiel Interferon

Gibt man zum Beispiel die Gensequenz "AAAACCTTAAGAAATATTTT" in das Eingabeformular ein und startet dann eine eingeschränkte Suche nach ähnlichen Genabschnitten in Mensch, Maus und Ratte, so zeigt sich, dass es sich bei der Information um einen Teil des gamma-Interferon-Gens handelt. Interferone spielen eine wichtige Rolle bei der Immunantwort. Sie können bestimmte weiße Blutkörperchen so aktivieren, dass sie Bakterien zerstören. Auch bei Virus-Erkrankungen, wie Gelbsucht, hat sich eine Behandlung mit Interferonen bewährt. Die Suche im NGFN-BLAST zeigt zudem, welche Interferone durch Patente geschützt sind. Veränderungen in der eingegebenen Buchstabenfolge oder bei den Suchparametern führen zu anderen Ergebnissen.

Thomas Gazlig | Presseinformation
Weitere Informationen:
http://www.gbf.de/forschung/ngfn/index.html
http://www.gbf.de/
http://www.rzpd.de/ngfn/

Weitere Berichte zu: BLAST-Server Gensequenz Interferon Sequenzvergleich

Weitere Nachrichten aus der Kategorie Biowissenschaften Chemie:

nachricht Multifunktionaler Mikroschwimmer transportiert Fracht und zerstört sich selbst
26.04.2018 | Max-Planck-Institut für Intelligente Systeme

nachricht Der lange Irrweg der ADP Ribosylierung
26.04.2018 | Max-Planck-Institut für Biologie des Alterns

Alle Nachrichten aus der Kategorie: Biowissenschaften Chemie >>>

Die aktuellsten Pressemeldungen zum Suchbegriff Innovation >>>

Die letzten 5 Focus-News des innovations-reports im Überblick:

Im Focus: Why we need erasable MRI scans

New technology could allow an MRI contrast agent to 'blink off,' helping doctors diagnose disease

Magnetic resonance imaging, or MRI, is a widely used medical tool for taking pictures of the insides of our body. One way to make MRI scans easier to read is...

Im Focus: Fraunhofer ISE und teamtechnik bringen leitfähiges Kleben für Siliciumsolarzellen zu Industriereife

Das Kleben der Zellverbinder von Hocheffizienz-Solarzellen im industriellen Maßstab ist laut dem Fraunhofer-Institut für Solare Energiesysteme ISE und dem Anlagenhersteller teamtechnik marktreif. Als Ergebnis des gemeinsamen Forschungsprojekts »KleVer« ist die Klebetechnologie inzwischen so weit ausgereift, dass sie als alternative Verschaltungstechnologie zum weit verbreiteten Weichlöten angewendet werden kann. Durch die im Vergleich zum Löten wesentlich niedrigeren Prozesstemperaturen können vor allem temperatursensitive Hocheffizienzzellen schonend und materialsparend verschaltet werden.

Dabei ist der Durchsatz in der industriellen Produktion nur geringfügig niedriger als beim Verlöten der Zellen. Die Zuverlässigkeit der Klebeverbindung wurde...

Im Focus: BAM@Hannover Messe: Innovatives 3D-Druckverfahren für die Raumfahrt

Auf der Hannover Messe 2018 präsentiert die Bundesanstalt für Materialforschung und -prüfung (BAM), wie Astronauten in Zukunft Werkzeug oder Ersatzteile per 3D-Druck in der Schwerelosigkeit selbst herstellen können. So können Gewicht und damit auch Transportkosten für Weltraummissionen deutlich reduziert werden. Besucherinnen und Besucher können das innovative additive Fertigungsverfahren auf der Messe live erleben.

Pulverbasierte additive Fertigung unter Schwerelosigkeit heißt das Projekt, bei dem ein Bauteil durch Aufbringen von Pulverschichten und selektivem...

Im Focus: BAM@Hannover Messe: innovative 3D printing method for space flight

At the Hannover Messe 2018, the Bundesanstalt für Materialforschung und-prüfung (BAM) will show how, in the future, astronauts could produce their own tools or spare parts in zero gravity using 3D printing. This will reduce, weight and transport costs for space missions. Visitors can experience the innovative additive manufacturing process live at the fair.

Powder-based additive manufacturing in zero gravity is the name of the project in which a component is produced by applying metallic powder layers and then...

Im Focus: IWS-Ingenieure formen moderne Alu-Bauteile für zukünftige Flugzeuge

Mit Unterdruck zum Leichtbau-Flugzeug

Ingenieure des Fraunhofer-Instituts für Werkstoff- und Strahltechnik (IWS) in Dresden haben in Kooperation mit Industriepartnern ein innovatives Verfahren...

Alle Focus-News des Innovations-reports >>>

Anzeige

Anzeige

VideoLinks
Industrie & Wirtschaft
Veranstaltungen

Konferenz »Encoding Cultures. Leben mit intelligenten Maschinen« | 27. & 28.04.2018 ZKM | Karlsruhe

26.04.2018 | Veranstaltungen

Konferenz zur Marktentwicklung von Gigabitnetzen in Deutschland

26.04.2018 | Veranstaltungen

infernum-Tag 2018: Digitalisierung und Nachhaltigkeit

24.04.2018 | Veranstaltungen

VideoLinks
Wissenschaft & Forschung
Weitere VideoLinks im Überblick >>>
 
Aktuelle Beiträge

Weltrekord an der Uni Paderborn: Optische Datenübertragung mit 128 Gigabits pro Sekunde

26.04.2018 | Informationstechnologie

Multifunktionaler Mikroschwimmer transportiert Fracht und zerstört sich selbst

26.04.2018 | Biowissenschaften Chemie

Berner Mars-Kamera liefert erste farbige Bilder vom Mars

26.04.2018 | Physik Astronomie

Weitere B2B-VideoLinks
IHR
JOB & KARRIERE
SERVICE
im innovations-report
in Kooperation mit academics