Forum für Wissenschaft, Industrie und Wirtschaft

Hauptsponsoren:     3M 


Orientierung im Buchstaben-Dschungel der Gene


Suchmaschine "NGFN-BLAST" erleichtert Vergleich genetischer Daten im Internet

Die frei zugängliche Gen-Suchmaschine "NGFN-BLAST" der Gesellschaft für Biotechnologische Forschung (GBF) erleichtert es jetzt Wissenschaftlern herauszufinden, welche Informationen sich hinter ermittelten genetischen Sequenzen verbergen. Als erster öffentlicher BLAST-Server in Deutschland erlaubt der Dienst den Sequenzvergleich mit speziellen, durch die Nutzergemeinde ausgewählten Untergruppen wie zum Beispiel Mensch, Maus oder Ratte. Der BLAST-Server (BLAST = Basic Local Alignment Search Tool) ist Teil der Forschungsarbeiten der GBF im Nationalen Genomforschungsnetz (NGFN). Mitglieder aus dem NGFN erhalten einen bevorzugten Zugriff zu den Daten und können sich ihr Wunschmenü an Untergruppen zusammenstellen. Eine weitere Besonderheit des Dienstes ist der Verweis auf bereits patentierte Sequenzen. Für die wirtschaftliche Nutzung genetischer Daten ist dieser Service von hoher Bedeutung.

Ähnliche Buchstabenabfolgen in den Gensequenzen weisen oft auf eine Verwandschaft der kodierten Eiweiße hin und erlauben Rückschlüsse auf die Funktion der Gene. Zurzeit gibt es drei öffentliche Gendatenbanken, die Sequenzvergleiche ermöglichen. Deren Daten werden in den USA, Großbritannien und Japan gesammelt und abgeglichen. Eine gezielte Suche ist oft sehr mühsam, da bisher meist die passenden Gensequenzen aller in der Datenbank vorhandenen Organismen aufgelistet werden. Der NGFN-BLAST-Server greift auf diese Daten zurück, aktualisiert sie jedoch täglich, prüft sie auf Unstimmigkeiten und sortiert sie gemäß der gewünschten Untergruppen. Das System ist so flexibel, dass es bei Bedarf um zusätzliche Untergruppen erweitert werden kann. Damit ist der Dienst ein wichtiges Werkzeug, um die Datenberge aus der Genomforschung nicht nur zu sammeln, sondern auch zu interpretieren.

Arbeitsweise des Dienstes: Beispiel Interferon

Gibt man zum Beispiel die Gensequenz "AAAACCTTAAGAAATATTTT" in das Eingabeformular ein und startet dann eine eingeschränkte Suche nach ähnlichen Genabschnitten in Mensch, Maus und Ratte, so zeigt sich, dass es sich bei der Information um einen Teil des gamma-Interferon-Gens handelt. Interferone spielen eine wichtige Rolle bei der Immunantwort. Sie können bestimmte weiße Blutkörperchen so aktivieren, dass sie Bakterien zerstören. Auch bei Virus-Erkrankungen, wie Gelbsucht, hat sich eine Behandlung mit Interferonen bewährt. Die Suche im NGFN-BLAST zeigt zudem, welche Interferone durch Patente geschützt sind. Veränderungen in der eingegebenen Buchstabenfolge oder bei den Suchparametern führen zu anderen Ergebnissen.

Thomas Gazlig | Presseinformation
Weitere Informationen:

Weitere Berichte zu: BLAST-Server Gensequenz Interferon Sequenzvergleich

Weitere Nachrichten aus der Kategorie Biowissenschaften Chemie:

nachricht Auf der molekularen Streckbank
24.02.2017 | Technische Universität München

nachricht Sicherungskopie im Zentralhirn: Wie Fruchtfliegen ein Ortsgedächtnis bilden
24.02.2017 | Johannes Gutenberg-Universität Mainz

Alle Nachrichten aus der Kategorie: Biowissenschaften Chemie >>>

Die aktuellsten Pressemeldungen zum Suchbegriff Innovation >>>

Die letzten 5 Focus-News des innovations-reports im Überblick:

Im Focus: „Vernetzte Autonome Systeme“ von acatech und DFKI auf der CeBIT

Auf der IT-Messe CeBIT vom 20. bis 24. März präsentieren acatech – Deutsche Akademie der Technikwissenschaften und das Deutsche Forschungszentrum für Künstliche Intelligenz (DFKI) in Kooperation mit der Deutschen Messe AG vernetzte Autonome Systeme. In Halle 12 am Stand B 63 erwarten die Besucherinnen und Besucher unter anderem Roboter, die Hand in Hand mit Menschen zusammenarbeiten oder die selbstständig gefährliche Umgebungen erkunden.

Auf der IT-Messe CeBIT vom 20. bis 24. März präsentieren acatech – Deutsche Akademie der Technikwissenschaften und das Deutsche Forschungszentrum für...

Im Focus: Kühler Zwerg und die sieben Planeten

Erdgroße Planeten mit gemäßigtem Klima in System mit ungewöhnlich vielen Planeten entdeckt

In einer Entfernung von nur 40 Lichtjahren haben Astronomen ein System aus sieben erdgroßen Planeten entdeckt. Alle Planeten wurden unter Verwendung von boden-...

Im Focus: Mehr Sicherheit für Flugzeuge

Zwei Entwicklungen am Lehrgebiet Rechnerarchitektur der FernUniversität in Hagen können das Fliegen sicherer machen: ein Flugassistenzsystem, das bei einem totalen Triebwerksausfall zum Einsatz kommt, um den Piloten ein sicheres Gleiten zu einem Notlandeplatz zu ermöglichen, und ein Assistenzsystem für Segelflieger, das ihnen das Erreichen größerer Höhen erleichtert. Präsentiert werden sie von Prof. Dr.-Ing. Wolfram Schiffmann auf der Internationalen Fachmesse für Allgemeine Luftfahrt AERO vom 5. bis 8. April in Friedrichshafen.

Zwei Entwicklungen am Lehrgebiet Rechnerarchitektur der FernUniversität in Hagen können das Fliegen sicherer machen: ein Flugassistenzsystem, das bei einem...

Im Focus: HIGH-TOOL unterstützt Verkehrsplanung in Europa

Forschung am Karlsruher Institut für Technologie (KIT) unterstützt die Europäische Kommission bei der Verkehrsplanung: Anhand des neuen Modells HIGH-TOOL lässt sich bewerten, wie verkehrspolitische Maßnahmen langfristig auf Wirtschaft, Gesellschaft und Umwelt wirken. HIGH-TOOL ist ein frei zugängliches Modell mit Modulen für Demografie, Wirtschaft und Ressourcen, Fahrzeugbestand, Nachfrage im Personen- und Güterverkehr sowie Umwelt und Sicherheit. An dem nun erfolgreich abgeschlossenen EU-Projekt unter der Koordination des KIT waren acht Partner aus fünf Ländern beteiligt.

Forschung am Karlsruher Institut für Technologie (KIT) unterstützt die Europäische Kommission bei der Verkehrsplanung: Anhand des neuen Modells HIGH-TOOL lässt...

Im Focus: Zinn in der Photodiode: nächster Schritt zur optischen On-Chip-Datenübertragung

Schon lange suchen Wissenschaftler nach einer geeigneten Lösung, um optische Komponenten auf einem Computerchip zu integrieren. Doch Silizium und Germanium allein – die stoffliche Basis der Chip-Produktion – sind als Lichtquelle kaum geeignet. Jülicher Physiker haben nun gemeinsam mit internationalen Partnern eine Diode vorgestellt, die neben Silizium und Germanium zusätzlich Zinn enthält, um die optischen Eigenschaften zu verbessern. Das Besondere daran: Da alle Elemente der vierten Hauptgruppe angehören, sind sie mit der bestehenden Silizium-Technologie voll kompatibel.

Schon lange suchen Wissenschaftler nach einer geeigneten Lösung, um optische Komponenten auf einem Computerchip zu integrieren. Doch Silizium und Germanium...

Alle Focus-News des Innovations-reports >>>



im innovations-report
in Kooperation mit academics

Aufbruch: Forschungsmethoden in einer personalisierten Medizin

24.02.2017 | Veranstaltungen

Österreich erzeugt erstmals Erdgas aus Sonnen- und Windenergie

24.02.2017 | Veranstaltungen

Big Data Centrum Ostbayern-Südböhmen startet Veranstaltungsreihe

23.02.2017 | Veranstaltungen

Weitere VideoLinks >>>
Aktuelle Beiträge

Fraunhofer HHI auf dem Mobile World Congress mit VR- und 5G-Technologien

24.02.2017 | Messenachrichten

MWC 2017: 5G-Hauptstadt Berlin

24.02.2017 | Messenachrichten

Auf der molekularen Streckbank

24.02.2017 | Biowissenschaften Chemie